45 is what percent of 82
what percent of 5 is 26
Round each answer to the nearest TENTH!

HELP FINALS TODAY :(

Answers

Answer 1

Answer:

45 is 54.9 percent of 82.

26 is 520% of 5.

Answer 2

Answer:

45 is 55% of 82 and 520% of 5 is 26.

Step-by-step explanation:

First you want to set up a proportion, using the is over of formula (Is/of= %/100). In the first problem, 45 will be the is, 82 will be the of, for % will be the x, and 100 will go on the bottom (it will look something like this: 45/82=x/100). When you solve it, you get around 55 (45x100/82.) Same thing for the next equation, use the same formula (is/of=%/100) which turns into: 5/26= x/100 and you get 520%.


Related Questions

Nancy is baking a cake. The recipe calls for seven cups of flour and three cups of sugar . She already put in 1/2 a cup of flour. How many more cups of flour does need to add? Write your answer in decimal form.

Answers

Answer:

6 1/2................

Pls Pls Pls help! Simplify the equation: [tex]\sqrt{\frac{1}{9} x^{2}y^{10}[/tex]

Answers

the answer is xy^5/3 .

2x - 1 = 17...............

Answers

Answer:

x = 9

Step-by-step explanation:

2x - 1 + 1 = 17 + 1

2x = 18

(2x=18)/2

x = 9

Answer:

2x - 1 = 17

add 1 on each side --> 2x = 18

x = 9 because one divides 2 from each side  and results to 9

Step-by-step explanation:

showing ALL calculations, whether this statement is valid
Rammone invests R505 050.00 for three years at a banking institution when
will grow at 5% compound interest per year.
2.2.1
Use a yearly STEP by STEP or a long method and calculate the
interest earned after three years. (Do not use the compound intere
formula.)​

Answers

Answer:

RM79 608.51

Step-by-step explanation:

First year,

RM505 050.00×5%=RM505 050.00×5/100

=RM25 252.50

second year,

(RM505 050.00+RM25 252.50)×5%=RM530 302.50×5/100

=RM26 515.13

third year,

(RM530 302.50+RM26 515.13)×5%=RM556817.63×5/100

=RM27840.88

three years interest,

RM25 252.50+RM26 515.13+RM27840.88=RM79608.51

I don't know that is R or RM

if it is R ,sorry

Hope can help!

PLSS HELP ASAP!!!! I’ll give you 30 points!!!

Answers

Answer:

174.8 in²

Step-by-step explanation:

Shaded area = square area - circle area

---------------------

Square

a = 15 * 15

a = 225

Circle

a = π * 4²

a = 3.14 * 16

a = 50.24

------------------------

Shaded

a = 225 - 50.24

a = 174.76

Rounded

174.8 in²

1. how many cubic meters are in 250,000 cubic centimeters?
A. 0.025m³ B. 0.25m³ C. 2.50 m³ D. 25

2. the volume of an ordinary box is 3.5 m³. wxpress its volume in cm³?
A. 350 cm³ B. 35000 cm³ C. 3500000 cm³ D. 35000000 cm³

3. Write 1.6 dm³ in cubic centemeters.
A. 1.6 cm B. 16 cm³ C. 160 cm³ D. 1600 cm

4. What is 500dm³ in m³?
A. 0.005 m³ B. 0.05m³ C. 0.5 m³ D. 5 m³

Answers

Answer:

1) 1m³ is 100cm*100cm*100cm = 1,000,000cm³

so 250,00cm³ are just 0.25m³

2) looking at the conversion above, three point five million is correct

3) 1dm³ = 10cm*10cm*10cm = 1,000cm³

D, as in Dewey Duck

4) 1m³ = 10dm*10dm*10dm = 1,000dm³

see that it's C?

Fifty percent of the customers who go to Sears Auto Center for tires buy four tires and 30% buy two tires. Moreover, 18% buy fewer than two tires, with 5% buying none.
a. What is the probability that a customer buys three tires?
b. Construct a cumulative probability distribution for the number of tires bought.

Answers

Answer:

A. Probability = 0.02

B. This is in a cumulative frequency table in the attachment I added

Step-by-step explanation:

A. We have these following probabilities

Prob(X=0) = 0.05

Prob(x= 2) = 0.30

Prob(X = 4) = 0.50

Prob(X < 2) = Prob(X=0) + prob(X=1)

0.18 = 0.05 + prob(X=1)

prob(X=1) = 0.13

A. Prob(x = 3)

= 1 - (0.05 + 0.13 + 0.30 + 0.50)

= 0.02

Probability of buying only 3 times = 2%

B. The cumulative frequency is in the attachment.

Write a word description of the set.
{1, 3, 5, 7, 9, 11, 13}
The set of odd natural numbers is less than

Answers

Answer:

if this is multiple choice then you forgot to give us the answers. the best answer i can give you is "the set of odd numbers is less than 15 because it does not exceed 13

A word description of sets is given below.

We have the following set -  {1, 3, 5, 7, 9, 11, 13}.

We have to write a word description of set.

What is Set ?

A set is a collection of elements or members, which can be mathematical objects of any kind for example → numbers, symbols, points in space, lines, other geometrical shapes, variables, or even other sets.

According to the question, we have the following set -

{1, 3, 5, 7, 9, 11, 13}

The above set is written in Roster or enumeration notation with the members enlisted between the curly braces. This set consist of 7 elements and each element of this set can be determined using the following rule -

a(n) = 2n - 1

This also represents the set of odd positive integers.

To learn more about sets, visit the link below-

https://brainly.com/question/19257002

#SPJ2

Is 3 Liters equal to 300 mL. Is 3 yards equal to 12 feet. Is 3 tons equal to 9,000 lb

Answers

Answer:

3 Liters = 3000 ml

3 Yards = 12 feet

3 tons = 6000 lb.

Hope that this helps!

Answer:

3 Liters is equal to 3,000 mL

3 Yards is equal to 9 feet

3 Tons is 6,000 lbs

Step-by-step explanation:

Hope this helped!

Which expression is equivalent to 1/2x + 8

Answers

Answer:

1/2( x+16)

Step-by-step explanation:

1/2x + 8

Factor out 1/2

1/2*x + 1/2 *16

1/2( x+16)

What is the line of the slope below? the first answer gets brainliest. pls help asap

Answers

Slope = y2-y1/x2-x1

Slope = -5-5/3+2= -10/5

Slope = -2 so the answer is B

In the triangle below, what is the cosine of 45°? Someone please help ASAP

Answers

Answer:

B. 1/√2

Step-by-step explanation:

Soh Cah Toa

cos is adjacent over hypotenuse so from either 45° degree angle it is 1/√2

For the given right angle triangle, cos 45 = 1/√2

Hence, option B is correct.

In the given triangle,

Adjacent  = 1

Hypotenuse = √2

Since we know,

The values of all trigonometric functions depending on the ratio of sides of a right-angled triangle are defined as trigonometric ratios. The trigonometric ratios of any acute angle are the ratios of the sides of a right-angled triangle with respect to that acute angle.

For a right angled triangle,

Cosθ = adjacent / hypotenuse

Therefore,

cos 45 = 1/√2

To learn more about trigonometric ratios visit:

https://brainly.com/question/29156330

#SPJ6

Mr. Akika has 33 18 cent and 32 cent stamps all told. The stamps are worth $9.02. How many of each kind of stamp does he have? Mr. Akika has 18 cent stamps and 32-сent stamps Enter your answer in each of the answer boxes.​

Answers

Answer:

Mr. Akika has 11 18-cent stamps and 22 32-cent stamps.

Step-by-step explanation:

Given that Mr. Akika has 33 18 cent and 32 cent stamps all told, and the stamps are worth $ 9.02, to determine how many of each kind of stamp does he have the following calculation must be performed:

10 x 0.18 + 23 x 0.32 = 9.16

11 x 0.18 + 22 x 0.32 = 9.02

Therefore, Mr. Akika has 11 18-cent stamps and 22 32-cent stamps.

Which statement describes the graph?

Answers

Answer:

A

Step-by-step explanation:

The answer is A, the graph raises, crosses at (0, 5) and then remains constant.

If you are multiplying by the vertical method as seen below, what is the value of C?

QUICK QUESTION!

Answers

Answer:

option 1

Step-by-step explanation:

     [tex]x^2[/tex]      [tex]-2x[/tex]         [tex]+8[/tex]

                [tex]x[/tex]           [tex]-4[/tex]

_____________________

        [tex]-4x^2[/tex]     +8x        -32

[tex]x^3[/tex]      [tex]-2x^2[/tex]     +8x          0

_______________________

[tex]x^3[/tex]      [tex]-6x^2[/tex]     +16x       -32

[tex]A =+ 8x\\\\B = -2x^2\\\\C= +16x[/tex]

How many rows of seats are needed to seat 673 people at a concert when the rows seat 37 people each?

Answers

Answer:

18.189 rows

Step-by-step explanation:

673 / 37 = 18.189189189

Hope this helps!

What is the slope of the line represented by the equation y = -1/2X + 1/4?

Answers

If the equation of the line is y=-1/2x+1/4 then the slope would be -1/2

which function is shown in the graph below?

Answers

The second choice is the correct answer because the function is shifted up 3 and over to the left 2

5+x^2-7x in standard form

Answers

standard form: x^2-7x+5

Select all the numbers that are solutions to the inequality 4,5,,6>5,5.2>5,5.01>5,0.5
Plzzz answer I’ll give you 10 points

Answers

iii; iv; and v

Step-by-step explanation:

I think

Solve for 2. Round to the nearest tenth of a degree, if necessary.
L
90
K
80
J

Answers

42 degrees use sin a/a= sin b/b= sin c/c and plug in what you know from this you cross multiply and use inverse sin to get a degree which is 41.8 and 42 tk the nearest tenth

Answer:

41.6

Step-by-step explanation:

got it wrong and it showed me the right answer

10 1/16ft + 8 3/8ft +1/2 ft

Answers

Answer:

18 15/16 ft

Step-by-step explanation:

what is the request here ?

to do the additions and bring all to one summary result of ft ?

I base my answer on this assumption.

10 1/16 = 161/16

8 3/8 = 67/8

1/2 = 1/2

note let's bring everything to 16th, so that we can actually add them.

161/16

67/8 = 134/16

1/2 = 8/16

161/16 + 134/16 + 8/16 = 303/16 = 18 15/16

cross check :

add all whole numbers first, and then add the remaining fractions too (need to bring them to 16th too).

10 + 8 = 18

1/16 + 3/8 + 1/2 = 1/16 + 6/16 + 8/16 = 15/16

together, 18 15/16

yeah, it is the same.

AT YOUR NEW JOB AT THE COFFEE
SHOP, YOU SOLD 42 LARGE
COFFEES AND 54 SMALL COFFEES.
WHAT WAS THE RATIO OF LARGE
TO SMALL COFFEES YOU SOLD?

Answers

9514 1404 393

Answer:

  7 : 9

Step-by-step explanation:

The ratio of interest is ...

  large coffees : small coffees = 42 : 54 = 7 : 9

When 390 junior college students were surveyed,115 said that they have previously owned a motorcycle. Find a point estimate for p, the population proportion of students who have previously owned a motorcycle.

a. 0.705
b. 0.228
c. 0.295
d. 0.418

Answers

Answer:

0.2948 ≅ 0.295

Step-by-step explanation:

According to the Question,

Given, 390 junior college students were surveyed,115 said that they have previously owned a motorcycle .

So, the population proportion of students who have previously owned a motorcycle is 115/390 ⇔ 0.2948 ≅ 0.295

Helppppppp! 15 points!

Answers

[tex]{\boxed{\mathcal{\purple{D.\:81}}}}[/tex] ✅

[tex]\large\mathfrak{{\pmb{\underline{\red{Step-by-step\:explanation}}{\orange{:}}}}}[/tex]

[tex]( {3})^{ \frac{11}{5} } \div {3}^{ \frac{ - 9}{5} } \\ \\=( {3})^{ \frac{11}{5} - ( \frac{ - 9}{5} ) } \\ \\ = ( {3})^{ \frac{11}{5} + \frac{9}{5} } \\ \\ = ( {3})^{ \frac{11 + 9}{5} } \\ \\ = ( {3})^{ \frac{20}{5} } \\ \\ = ( {3})^{4} \\ \\ = ( \: 3 \times 3 \times 3 \times 3 \: ) \\ \\ = 81[/tex]

Note:-

[tex] {a}^{m} \div {a}^{n} = {a}^{m - n} [/tex]

[tex]\sf\red{(-)\:x\:(-)\:=\:+}[/tex]

[tex]\large\mathfrak{{\pmb{\underline{\orange{Happy\:learning }}{\orange{!}}}}}[/tex]

Which of the following correctly simplifies the expression 2 to the power of 3 multiplied by 3 to the power of 0 whole over 5, the whole squared.? (5 points)


2 to the power of 3 multiplied by 1 whole over 5, the whole squared. = 2 to the power of 6 multiplied by 1 squared over 5 squared. = 64 over 25.

2 to the power of 3 multiplied by 1 whole over 5, the whole squared. = 2 to the power of 5 multiplied by 1 squared over 5 cubed. = 32 over 125.

2 to the power of 3 multiplied by 0 whole over 5, the whole squared. = 2 to the power of 6 multiplied by 0 over 5 squared. = 0

2 to the power of 3 multiplied by 0 whole over 5, the whole squared. = 2 to the power of 5 multiplied by 0 over 5 cubed. = 0

Answers

9514 1404 393

Answer:

  (a)  64/25

Step-by-step explanation:

The relevant properties of exponents are ...

  a^0 = 1 . . . . a ≠ 0

  (a^b)^c = a^(bc)

  (ab)^c = (a^c)(b^c)

__

Your expression simplifies to ...

  [tex]\left(\dfrac{2^3\cdot3^0}{5}\right)^2=\dfrac{2^{3\cdot2}\cdot1^2}{5^2}=\dfrac{2^6}{5^2}=\boxed{\dfrac{64}{25}}[/tex]

Help me!! Which statement is correct?

Answers

Answer:

D option is correct

( At Q3 the market is wasting society's .. )

In ΔDEF, the measure of ∠F=90°, ED = 25, DF = 24, and FE = 7. What ratio represents the sine of ∠D?

Answers

Answer:

39/89

Step-by-step explanation:

Answer:

7/25

Step-by-step explanation:

(sin) = opp/hyp

TRIGONOMETRY (RIGHT ANGLE) PLEASE HELP

Answers

Answer:

x = 41.05

Step-by-step explanation:

Given that,

In a right angles triangle,

Perpendicular height, P = 228

Angle 1 = 90°

Angle 2 = 47°

Angle 3 = 180-(90+47) = 43°

Using trigonometry to find x.

[tex]\sin\theta=\dfrac{P}{x}\\\\x=\dfrac{P}{\sin\theta}\\\\x=\dfrac{28}{\sin(43)}\\\\x=41.05[/tex]

So, the value of x is equal to 41.05.

The first three terms of a sequence are given. Round to the nearest thousandth (if necessary).

50,20,8

Find the 8th term.

Answers

Answer:

.082

Step-by-step explanation:

First find the common ratio

Take the second term and divide by the first term

20/50 = 2/5 = .4

Check with the third term divided by the second term

8/20 = .4

The formula for a geometric sequence is

an = a1 (r) ^(n-1)  where a1 is the first term and r is the common ratio

     =50 ( .4) ^ (n-1)

We want to find the 8th term

     = 50 ( .4)^(8-1)

      = 50 ( .4) ^7

      =0.08192

Round to the nearest thousandth

      = .082

   

Hope this help!!!

Have a nice day!!!

Other Questions
PLEASE HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP please help please help the tRNA for GUCAUCGAUCGAUCGGAUGCC A red light flashes every 6 seconds A yellow light flashes every 4 seconds They both flash at the same time.After how many seconds will they next both flash at the same time? The radius of a right circular cone is increasing at a rate of 1.1 in/s while its height is decreasing at a rate of 2.6 in/s. At what rate is the volume of the cone changing when the radius is 107 in. and the height is 151 in. The elements in a long array of integers are roughly sorted in decreasing order. No more than 5 percent of the elements are out of order. Which of the following is the best method to use to sort the array in descending order?I. Insertion sort.Il. Merge Sort.III. Heap Sort.a. Ill only.b. I only.c. II and III only.d. I and II only.e. Il only I and.f. Ill only. Help please I asp !!! For A = R + PRT/100 make P the subject. 1. What are metabolic wastes?2. Which are the main organs of the excretory system? please help me with this The practice of selling indulgences troubled many Catholics because the practice made it seem like? Which sentence in the paragraph is structured differently than the others? Which territory did the Mongol Empire conqueror after Genghis Khan's death Because Japan felt disrespected by the provisions of the Treaty of Portsmouth, it would most likely lead Japan toA. an increase in aggressive imperialism.B. a desire to reclaim Manchuria from China.C. eventual revenge against the country of Russia.D.lack of trust in the US and future negotiations with it.Could someone help me with this question? Im kinda stuck with it Which statement about the mass and the weight of an object is correct?A They are both affected by changes in the acceleration of free fall.B They are both forces.C They have different units.D Weight is calculated by dividing mass by the acceleration of free fall. PLEASE HELP WILL MARK BRANLIEST!Fungi and bacteria are examples of _____:A. decomposers, B. producers, C. consumers, D. demagorgans Calculate the molality of each of the following solutions: (a) 14.3 g of sucrose (C12H22O11) in 685 g of water, (b) 7.15 moles of ethylene glycol (C2H6O2) in 3505 g of water. At what percent rate of compound interest p.a will the compound interest on rs343000be rs169000 in 3 years what are the childhood disease? How much current is drawn by a computer with a resistance of 42 that is connected across a potential difference of 220 V?9200 amps6.6 amps7.0 amps5.2 amps How can you find the y-coordinates of the midpoint of a vertical line segment with endpoints at (0,0) and (0,-12)? Check all that apply.A. add the endpointsB. divide 12 by 2C. divide -12 by 2D. multiply -12 by 2