Analyze: Click the FOREST tab. Click the plus (+) button for mushrooms several times. Click Advance year a few times. Select the DATA tab. How did adding mushrooms affect trees? GIZMOS.

Answers

Answer 1

Answer

82

Explanation:

i think

Answer 2

Answer:5b

Explanation:itchy


Related Questions

A substance only composed of one kind of atom is a(n) *

Answers

Element is your answer

Explanation it is on the periodic table

Explain how one celled organisms get oxygen in water.

Answers

Answer:

n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.

Explanation:

In eukaryotes the electron transport chain is composed of a series of electron carriers located in the blank of mitochondrion

Answers

Answer:

Facts that is right

Explanation:

In eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

The electron transport chain is composed of four large, multiprotein complexes. These protein complexes are formed of a series of electron carriers.

These complexes are embedded in the inner mitochondrial membrane and two small diffusible electron carriers shuttling electrons between them.These transfer electrons from electron donors to electron acceptors via redox reactions and joins this electron transfer with the transfer of protons across a membrane.

Thus, in eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

Learn more about:

https://brainly.com/question/7135096

A water molecule is attracted to another water molecule. This is an example of

Answers

This is an example of cohesion. :)

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content

Answers

Answer:

B

Explanation:

YOOOOOOOOOOOOOOOOOOOOOO

ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?

Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?

Answers

Answer:

Wedging (for the first one)

Explanation:

What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?

Answers

Hhhyyyyyggvvvvvvbhhhhhyyyyyggggghgggggffcvvvfffffffhz gzmysmydyysudkdjdisrw and the dttyyuuuuiiiiuuuuu

4) How does climate affect ecosystems and the life within them?

Answers

Answer:

Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.

When you exhale, what happens in the lungs?
A. Air moves from high pressure (in the lungs) to low pressure (outside)
B. Space in the lungs increases
C. Lung pressure decreases
D. Air moves from low pressure (in the lungs) to high pressure (outside)

Answers

Answer:

Conversely, exhalation moves the diaphragm up into the chest cavity and reduces the space in it. This forces the air, which is dense with carbon dioxide at that point, out of the lungs and windpipe. It then exits the body either through the nose or mouth. Usually, this requires no physical effort from the body.

Explanation:

So its A

Give two examples of why water is important to the human body.

Answers

Answer: Your body uses water in all its cells, organs, and tissues to help regulate temperature and maintain other bodily functions. Because your body loses water through breathing, sweating, and digestion, it's important to rehydrate by drinking fluids and eating foods that contain water.

fill in the complementary bases according to the base-pair rule.

a | t | c | c | g | a | t | a | g | c | t | t | a | g

Answers

t/a/g/g/c/t/a/t/c/g/a/a/t/c

What is typical of cell reproduction when cancer cells are reproduced in a petri dish from a tissue culture? Check all that apply.

Answers

Answer:

Cells reproduce without limit. Cells reproduce with multiple cells

Tissue culture I haven’t studied that tho,....lkkeodkekfkeofk

What is H₂O - H₂+ boz

Answers

Answer:

-tH2

H20 - H2 + boz

0-H2t

-tH2

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule? What happens to the other 66%?

Answers

Answer:

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule is because of  the process of cellular respiration. And what happens to the other 66% is that it's  used to make water from hydrogen ions and oxygen that converted to heat and used directly for energy to store as fat

Explanation:

Please Help me as soon as possible.

In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.

Answers

Answer:

The answer is; c

It is important to distinguish between codominance and incomplete dominance.

In incomplete dominance, the two alleles blend with each other in phenotype  giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.

In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.

Explanation:

Give two examples each of centripetal force​

Answers

Answer:

Spinning a ball on a string or twirling a lasso: Here the centripetal force is provided by the force of tension on the rope pulls the object in toward the centre. Turning a car: Here the centripetal force is provided by the frictional force between the ground and the wheels.

Explanation:

Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid

Answers

Answer:

Lipid is the most likely answer.

What components are needed for
photosynthesis?

Answers

Answer:

sunlight, carbon dioxide, and water as substrates

Explanation:

Hope this helps :]

Answer:

Explanation:

chicken leg piece and/Photosynthesis is a multi-step process that requires sunlight, carbon dioxide, and water as substrates. It produces oxygen and glyceraldehyde-3-phosphate (G3P or GA3P), simple carbohydrate molecules that are high in energy and can subsequently be converted into glucose, sucrose, or other sugar molecules.

What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?

Answers

The proton gradient produced by proton pumping during the electron transport chain is used to synthesize ATP. Protons flow down their concentration gradient into the matrix through the membrane protein ATP synthase, causing it to spin (like a water wheel) and catalyze conversion of ADP to ATP.

Which is the process by which gas exchange between the respiratory system and the blood cells in the cappilaries occurs? transfusion condensation evaporation diffusion

Answers

Answer:

Diffusion

Explanation:

Diffusion is the process by which molecules of substances move from regions of higher concentration to regions of lower concentration until equilibrium concentration is attained. This movement of molecules is because a concentration gradient exists between the two regions.

Blood cells in the capillaries is low in oxygen because the cells have used up the oxygen in cellular respiration. However, in the lungs, the oxygen concentration is high due to inspiration of oxygen from the external environment. Therefore, a concentration gradient exists between the lungs and blood cells in the capillaries. Oxygen from the lungs diffuses into the blood cells in the capillaries, and these blood cells are then returned to other parts of the body by the circulatory system. This is a continuous process and is known as gaseous exchange.

Answer:

Diffusion

Explanation:

ASAPPPP!!!!
Write step by step instructions for making a protein

Answers

Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. Transcription is the transfer of genetic instructions in DNA to mRNA in the nucleus. It includes three steps: initiation, elongation, and termination.

WILL GIVE BRAINLIEST!!!!!!
An amino acid is to a polypeptide as:

glycogen is to glucose.

testosterone is to a steroid hormone.

a phospholipid is to a plasma membrane.

a nucleotide is to a nucleic acid.

Answers

Answer would be D!
Mark brainliest

are bones living or non living and why

Answers

Answer:

i think they are non living

Explanation:

because they dont have organs or blood or anything

Answer:

Bones are non living

Explanation:

1: Bones don’t movement on their own

2: Bones don’t have cells

3: Bones do bot breathe

4: They do not count on anything to survive

5: They are just something that helps a living organism to move

Which of the following statements supports the need for a handler to know an animal’s point of balance? A handler must know an animal’s pattern of movement in order to avoid injury. A handler must know where to stand in order to avoid injury. A handler must know proper feeding procedures in order to avoid injury. A handler must not use a loud voice in order to avoid injury.

Answers

Answer:

A handler must know an animal’s pattern of movement in order to avoid injury.

Explanation:

Point of balance refers to equalibrium so if you know the animals pattern of movemenrt you are less likely to get injured while moving on or with it.

Answer:

A

Explanation:

i got it wrong and it showed the correct answer

question one : when two plates converge, they are what?

a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other

question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other

question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age

Answers

Q1. They are d. colliding with each other.

Q2. They are c. sliding along each other (in a processes called “subduction”)

Q3. Rocks furthest away from the ridge are b. oldest the further away you move from the ridge. The youngest rocks can be found closest to the mid ocean ridge.

what is the percentage of thymine in wheat ?

Answers

Answer:

27.1% or 27% if rounded

Explanation:

Hope this helps ya!!

The law of___________explains how traits are inherited through generations.

Answers

Answer:

the law of inheritance


What would be the temperature at a depth of 2500 km?


Answers

Answer:

4700 Degrees Celsius

Explanation:

hurry due in five min plz help

Answers

Answer:

b

Explanation:

Answer:

d

Explanation:

I hope that helped!

Other Questions
Spiro Corp. uses the sum-of-the-years' digits method to depreciate equipment purchased in January year 1 for $20,000. The estimated salvage value of the equipment is $2,000 and the estimated useful life is four years. What should Spiro report as the asset's carrying amount as of December 31, year 3 magdalena creates the drawing shown of a rectangular field . (length : 7.2 cm and height : 3 cm)she increases all the sides by a scale factor of 4 1/2. what is the area of the new figure? What is the circumference of the circle defined by x^2+6x +y^2-12y-4=0. Evaluate the Expression: 8r - 4w - 9 when r = 7 and w = 4 14. What was the main purpose of the Platt Amendment?A. To make it where no Europeans could control land in the Americas. B. To give the UnitedStates the right to intervene in Cuban affairs at any time. C. To give the United States theright to take over countries who have foreign debts. D. To give the United States the rightto defend Cuba against European nations. Which table represents a linear function? Most people remember Gandhi and Dr. Martin Luther King, Jr. as reformers who practiced non-violent forms of protest and advocacy. Both effectively changed the popular opinion about emotional issues for their countries and brought in a wave of change that was long overdue. But the practice of non-violent protest, or civil disobedience, started long before either Gandhi or King. It began with a quiet, shy poet who is best known for writing a lot about a pond.Henry David Thoreau lived from 1817 until 1862, mainly in the area of Concord, Massachusetts. The issue that would tear the country apart in the 1860s had already begun dividing the nation. Thoreau was only 14 when Nat Turner led the slave rebellion in Virginia and was later hanged. In his late 20s, Thoreau began speaking against slavery in public, echoing the voices of freedmen like Frederick Douglass and Lewis Hayden.Thoreau believed that a government that supported slavery was corrupt and immoral. He was also deeply suspicious of government. For these and other reasons, Thoreau refused to pay his poll tax for a number of years. The poll tax was a legal tax owed by every person. It was basically a tax on one's body. After not paying for years, he was at last arrested. He spent only one night in jail, however, as a relative paid the tax for him. He was reportedly furious that any tax was paid on his behalf.It was this experience that Thoreau wrote about in an essay called "Civil Disobedience." In this essay, he argued that being moral and just came before allegiance to government. He wrote If the machine of government is of such a nature that it requires you to be the agent of injustice to another, then, I say, break the law." He also felt that voting was not enough to ensure that the right thing be done. He wrote that "even voting for the right is doing nothing for it A wise man will not leave the right to the mercy of chance" He felt that one had a moral responsibility to resist unjust laws.Read the sentence below:"If the machine of government is of such a nature that it requires you to be the agent of injustice to another, then, I say, break the law."In this context, what does the word agent mean? The cause of The muscle of The power of The result of Which statement is correct about two objects that have gravitational force?They have mass.They move slowly.They are round in shape.They have high temperature. how did geography affect the civilizations in mesopotamia Probably the most important Supreme Court decision was_______in which the court ruled______. Joseph has 48 comic books. He sold one-fourth of his collection to his friend. He brought twice the number of comic books as he has now.how many comic books does he have now? Hi can someone help me with this question! First one to answer it I will make u brainliest Solve the equation. If the equation is an identity or if it has no solution, write identity or no solution.1) 7n + 5 9n = 8 2n 32) 4(t + 2) = 103) 4y+2=13(812y) Consider 8x2 - 48x = -104.Write the equation so thata = 1: x2 + x = Why would a historian wish to consult multiple sources of information on a topic? A) to confirm his or her own biases about a subject B) To corroborate a primary source's claim about an event C) To identify a research question to pursue D) To question his or her beliefs about an event Why work and energy both have same unit? Give reasons? Rico represents the inequality Negative 3 (StartFraction 8 over x minus 5 EndFraction greater-than negative 16) with the sentence "The product of 3 and the quotient of 8 and the difference of a number and 5 is at least 16." Which describes Rico's error? please help me on this i am struggling Please help!!Write the equation of the line passing through (2,3) and perpendicular to y = 2/3 x + 7. Given the relation y = 4x2 8, if the input is 2, what is the output?