Differences between the chromosphere and corona of the sun

Answers

Answer 1

Corona is the outermost layer whereas chromosphere is the transparent layer of the sun.

What is the differences between the chromosphere and corona of the sun?

Corona is the outermost, hot shell of the atmosphere of the sun while on the other hand, the chromosphere is a transparent layer present between the corona and the photosphere.

So we can conclude that Corona is the outermost layer whereas chromosphere is the transparent layer of the sun.

Learn more about sun here: https://brainly.com/question/15837114

#SPJ1

Answer 2

Answer:

I is a low density layer which is about 2,000km thick. It is called chromosphere because it has a red to pink colour. It is normally only visible during a solar eclipse. The corona is plasma surrounding the Sun which extends hundreds of kilometers from the surface of the Sun.


Related Questions

4. Which statement best describes how scientists formed cell theory?
A:Pasteur observed that cork was made of cells and published his findings
widely,
B:Multiple scientists and observations contributed to the formation of cell
theory.
C:Schwann observed that plants are made of cells and shared his theory at
conferences.
D:Remak wrote cell theory after realizing that cells cannot come from non-
living matter.

Answers

Answer:

A is the answer

Explanation:

please mark me as brainlist

Which ,begin emphasis,two,end emphasis, statements describe how constantly changing conditions affect the overall population size of organisms living in the area?

Answers

The correct options would be B and E.

Variation in population size

The population size of each organism in different zones may not vary much due to the following:

Organisms in each zone have characteristics that make them be well-adapted to the zone. These include structures that help them attach to the rock, structures that help them breathe when exposed to the air, and so on.

More on adaptations of organisms can be found here: https://brainly.com/question/1686177

#SPJ1

An organism that is eaten by a predator is

Answers

Prey is a term given to the organism that is eaten by the predators.

Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms?

Answers

The ease of identification of different organisms based on their characteristics is the reason why standardized taxonomic classification system is important.

What is Taxonomic classification system?

This is defined as the classification of organisms based on shared characteristics.

This makes it easier for scientists to group or determine the relatedness of the organisms in the ecosystem.

The complete question is:

Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differences in their structural and genetic characteristics.

Which of the following best explains why a standardized classification system is important to the scientific community?

Read more about Taxonomic classification system here https://brainly.com/question/11724129

#SPJ1

A model train running on an inclined track is part of a closed system that has
316 J of mechanical energy. If the kinetic energy of the train decreases from
314 J to 250 J, what happens to the gravitational potential energy of the system?

A. It decreases from 316 J to 314 J.

B. It increases from 2 J to 66 J.

C. It decreases from 66 J to 2 J.

D. It increases from 316 J to 564 J.

Answers

Taking into account the definition of kinetic, potencial and mechanical energy, the correct answer is option B: the gravitational potential energy of the system increases from 2 J to 66 J.

Kinetic energy

Kinetic energy is a form of energy. It is defined as the energy associated with bodies that are in motion and this energy depends on the mass and speed of the body.

Kinetic energy is defined as the amount of work necessary to accelerate a body of a given mass and at rest, until it reaches a given speed. Once this point is reached, the amount of accumulated kinetic energy will remain the same unless there is a change in speed or the body returns to its state of rest by applying a force.

Potential energy

On the other hand, potential energy is the energy that measures the ability of a system to perform work based on its position. In other words, this is the energy that a body has at a certain height above the ground.

Gravitational potential energy is the energy associated with the gravitational force. This will depend on the relative height of an object to some reference point, the mass, and the force of gravity.

Mechanical energy

Finally, mechanical energy is that which a body or a system obtains as a result of the speed of its movement or its specific position, and which is capable of producing mechanical work. Then:

Potential energy + kinetic energy = total mechanical energy

The principle of conservation of mechanical energy indicates that the mechanical energy of a body remains constant when all the forces acting on it are conservative (a force is conservative when the work it does on a body depends only on the initial and final points and not the path taken to get from one to the other.)

Therefore, if the potential energy decreases, the kinetic energy will increase. In the same way, if the kinetics decreases, the potential energy will increase.

Gravitational potential energy of the system in this case

The principle of conservation of mechanical energy can be applied in this case.

A model train running on an inclined track is part of a closed system that has 316 J of mechanical energy.

The kinetic energy of the train is 314 J at the beginning.

Replacing in the definition of mechanical energy:

Potential energy + 314 J = 316 J

and solving you get:

Potential energy = 316 J - 314 J

Potential energy= 2 J

Then, the potential energy of the train is 2 J at the beginning.

The kinetic energy of the train is 250 J at the end.

Replacing in the definition of mechanical energy:

Potential energy + 250 J = 316 J

and solving you get:

Potential energy = 316 J - 250 J

Potential energy= 66 J

Then, the potential energy of the train is 66 J at the end.

Finally, the correct answer is option B: the gravitational potential energy of the system increases from 2 J to 66 J.

Learn more about mechanical energy:

brainly.com/question/17809741

brainly.com/question/14567080

brainly.com/question/12784057

brainly.com/question/10188030

brainly.com/question/11962904

#SPJ1

Wild salmon spend most of their lives in the ocean but return to freshwater rivers to spawn, or reproduce. Most wild salmon will only spawn in specific spawning grounds in the rivers in which they were born. The construction of hydroelectric dams in rivers has blocked the paths of some salmon returning to their spawning grounds. This has led to population declines. Which method would be most effective in preventing further wild salmon population declines caused by the construction of hydroelectric dams?

A.
establishing protected regions around wild salmon spawning grounds in specific rivers
B.
observing the migration patterns of wild salmon by tagging and tracking a small sample of fish
C.
monitoring genetic diversity by using netting to catch salmon and obtain genetic samples
D.
constructing passageways next to dams to allow salmon to swim around blocked rivers

Answers

Constructing passageways near the dams to allow to salmon to swim around blocked rivers. Thus, option "D" is correct.

How, explain your answer briefly?

The construction of dams in rivers has blocked the path of  some salmons returning to spawning grounds.

The best way to overcome this is to make the passage ways near the dams to allow salmons to swim in areas which have blocked due to dams. So that salmons can returned to the spawning ground and can spawn which leads to increase in their population.

Thus, option "D" is correct.

To learn more about salmons click here:

https://brainly.com/question/16208604

#SPJ1

Which of the following is NOT approved for chemical sanitizing after washing and rinsing?
Quaternary ammonium
Chlorine
lodine
Detergent

Answers

the correct answer is detergent which is not approved

The chemical that is allowed for being used in hand sanitizing is quaternary ammonium, chlorine, and iodine. The one that is not included is detergent, i.e., option D.

What is a hand sanitizer?

Hand sanitizers are the solution made up of some chemicals including quaternary ammonium, chlorine, and iodine.

Detergents are not approved during the formation of hand sanitizer.

Thus, the correct option for the given scenario is D.

For more details regarding sanitization, visit:

https://brainly.com/question/4296165

#SPJ2

making nectar costs a plant energy because it uses up glucose that the plant has made. explain why the expense is worthwhile

Answers

Answer:

Nectar in flowers serves chiefly to attract pollinators, such as fruit-eating bats, hummingbirds, sunbirds, and insects. Nectaries are usually located at the base of the flower stamens, which draw animal visitors into contact with the pollen to be transferred.

Explanation:

For a long time, penicillin was given to people to kill the bacteria which caused ear infections. Lately, some ear infections are not cured by penicillin. Which is the best explanation for this?

Answers

Answer:

Some bacteria have mutated and are not killed by the penicillin

Explanation:

The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic. Which is which

Answers

Fatty acid tails = hydrophobic
Phosphate heads= hydrophilic

Genetic drift and natural selection … (a: never lead to different populations - - that happens by another mechanism in nature , (b:can lead to new species that share common ancestor.

Answers

Answer:

B.) Can lead to new species that share common ancestors

Explanation:

Genetic drift and natural selection both lead to evolution. This describes the change of a species overtime to be better suited for their environments. In some cases, this leads to the creation of an entirely new species (speciation).


How might compound leaves and leaves with lobed margins be well-suited to windy environments?

Answers

Compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

What is a plant adaptation?

A plant adaptation is any type of trait that confers an evolutionary advantage in a given environment.

Plant adaptations include, for example, the presence of fewer stomata in leaves in plants living in arid conditions.

In conclusion, compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

Learn more about plant adaptations here:

https://brainly.com/question/29594

#SPJ1

We can mold metals into different shapes because they are _____________.
ductile
malleable
lustrous

Answers

Answer:

We can mold metals into different shapes because they are _malleable__.

Explanation:

Malleable (ability to be hammered into thin sheets)

what would most likely happen if a person increased the amount of saturated fat in his or hers diet?

Answers

Answer: If a person increased the amount of saturated fat in his or her diet there is a chance of risk of cardiovascular disease would increase.

Explanation: Increase in the amount of saturated fat in diet results in the increase of levels of cholesterol in blood. This cholesterol is in the form of LDL.

If a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well.

What is the harmful effect of saturated fatty acids?

Because saturated fatty acids are completely saturated with hydrogen, they require more energy to break down and generally remain in the solid at room temperature, as well as inside the body, where they can induce heart-related diseases and obesity by blocking blood vessels. For example, butter contains saturated fatty acids, which are generally not recommended in large quantities.

Hence, if a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well..

Learn more about the harmful effects of saturated fatty acids here.

https://brainly.com/question/14118324

#SPJ2

Explain why it makes sense that the levels of estrogen and progesterone are low in blood of a female during menstruation

I'll give brainly to whoever response is good !
please help me :C

Answers

Answer:

At the beginning of the follicular phase, the lining of the uterus (endometrium) is thick with fluids and nutrients designed to nourish an embryo. If no egg has been fertilized, estrogen and progesterone levels are low. As a result, the top layers of the endometrium are shed, and menstrual bleeding occurs.

Who establishes a crime scene?

options:

crime scene photographer

criminal investigator

first responder

district attorney

Answers

Answer:

first responders

Explanation:

no need for explaining

The backbone is also known as the vertebral column. Justify in accordance with both the
terms used

Answers

dont say babe lol is it bc i’m black no hehehe rawr im doing this so i can literally get answers for this thing

3. Meiosis is a process that occurs during cell division that leads to the production of gametes It halves the number of chromosomes that can be passed on to an offspring. It also produces new combinations (variations) of an organism's genetic material Use evidence you obtained from modeling meiosis to show that both statements are true ​

Answers

Answer:

reproduction

Explanation:

different traits

Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factors in their work that could increase their chances of cancer?

Answers

This is the complete question.

Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factor

in their work that could increase their chances of cancer?

A. Scientists who work with toxic chemicals

B.therapist who operate radiation machine

C.nurses who treat patients with viral infections

D.researches who study DNA replication

Research that study DNA replication. Thus, option "D" is correct.

What is cancer?

Cancer directs to any one of a considerable number of diseases described by the growth of anomalous cells that separate uncontrollably and have the ability to enter and destroy ordinary body tissue.

Cancer often has the ability to spread throughout your body. Cancer is the second-main cause of dying in the world.

Thus, option "D" is correct.

To learn more about Cancer click here:

https://brainly.com/question/8590464

#SPJ1

PLEASE HELP PLEASE
Do you think this is a good way to eliminate invasive species from an ecosystem? Do you think the risks of the gene drive getting into another species are worth gaining biodiversity in an ecosystem? Explain your opinion.

Answers

Use of bioagent is a good way to eliminate invasive species from an ecosystem.

What is a good way to eliminate invasive species from an ecosystem?

In my opinion, to eliminate the invasive species from an ecosystem we should find out its bioagent instead of chemical spraying because bioagent does not adversely affected the environment.

The risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem because it leads to many consequences and unpredictable effects on ecosystem.

So we can conclude that use of bioagent is a good way to eliminate invasive species from an ecosystem.

Learn more about invasive here: https://brainly.com/question/1542287

#SPJ1

Yes, it is a good way to eliminate invasive species from an ecosystem. This is because invasive species play a critical role in the limitation of biodiversity of a particular ecosystem.

What is Biodiversity?

Biodiversity may be defined as the sum total of all the variety of living organisms in a particular ecosystem.

No, the risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem. This is because it directs considerable influences and unanticipated impacts on the ecosystem.

Therefore, it is well described above.

To learn more about the Ecosystem, refer to the link:

https://brainly.com/question/26551655

#SPJ1

how can global warming lead to changes to the Earth's surface?

Answers

Answer:

It could lead to the changes in the earths surface because it could open up geysers in the crater, causing the earths surface to change.

10 points!

A fungal ____________ is a haploid reproductive cell that is capable of developing into a new organism.

Answers

Answer:

it’s a spore

Explanation:

it should be a spore. It’s because the spore is the haploid.

Economic importance of tilapia fish

Answers

Answer:

Tilapia is one of the most productive and internationally traded food fish in the world. The production of farmed tilapia is among the fastest expanding food sectors in the world. Nile tilapia ( Oreochromis niloticus) is the most cultured freshwater species among the farmed tilapia and contributes about 71% of the world total tilapia production.

Tilapia is one of the most important farmed fish species worldwide (FAO 2018) and an important source of protein (Fitzsimmons 2000;Hai 2015). Due to its sequenced genome (Conte et al. 2017), easy reproduction, efficiency in adapting to diverse diets, high resistance to diseases and handling practices, and high tolerance of a wide variety of husbandry conditions, it is considered an ideal model in toxicological research.

Explanation:

I hope it helps

Which feature of the ocean floor includes its deepest parts?

Answers

Ocean Trenches also known as Deep Sea Trenches

One possible reason for the rise in the average air temperature at the Earth's surface is that

Answers

Answer:

cimate change

What process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates?

Answers

Answer:

Precipitation

Explanation:

Precipitation refers to a process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates.

Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Answers

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

https://brainly.com/question/15278286

#SPJ1

What factors can limit growth?

competition
amount of sunlight or water
r-selected species
geographic borders

Answers

The answer is

Amount of sunlight or water.

As growth depends on sunlight and water so it is important to grow a plant in proper sunlight and giving plants regular water is also important.

learn more things about what factors growth

https://brainly.com/question/3944507

The sugar and phosphate portion of the nucleotides are found _____ on the DNA twisted ladder.

Answers

The sugar and phosphate portion of the nucleotides are found "as segments of the rails" on the DNA twisted ladder.

Which of the following is a natural resource for humans?

A-Cars
B-Electricity
C-Houses
D-Wood

Answers

D. Wood

Wood is a natural resource whereas everything else isn’t.
Other Questions
The hour and minute hands of a clock form an angle that constantly changes. During each hour of the day, the clock hands will form right, acute, and obtuse angles. Assume the hour hand points directly at the hour.Write a time of day when the two clock hands form each type of angle Which expresstion is equivalent to 22 - 3 will get brainliest if answered right. no smart remarks An oblique cylinder has a radius of 9 centimeters and a volume of 486 cubic centimeters. Use Cavalieris Principle to calculate the height of the solid.6 meters5 meters8 meters7 meters What best describes the purpose of the foreshadowing present in the narrators words, Soon I could hear his voice no more? Failures of the competition policy of South Africa please help me with these questions???? Which of the following best summarizes the section, Road Map? A Scientists used to rely on a map that was based on the brain of just one woman, even though there is no way one woman could represent everyone on the planet. B The old map of the brain was that of just one person, but the new, 3-D model is based on data from thousands of brains and will help doctors better understand the brain. C Researchers will be able to interact online with the 3-D model, comparing and contrasting all sorts of information about the human brain. D Doctors still do not know why brain disorders like Alzheimer's disease affect some people but not others. please help! what is the angle of depression from point C to point A 4. (#18) A vine is 1.3 inches long now and it will grow 0.2 inches a day. Identify a rule for the linear function that describes the length of the vine. Use the rule to find the number of days it will take the vine to grow to be 10.3 inches long.5. (#24) Multiply (q-1)^22. (#6) The French club is sponsoring a bake sale to raise at least $305. How many pastries must they sell at $2.05 each in order to reach their goal? Identify the viral structure described.have a capsid that has polyhedral and helical characteristics, and may have extra structures like protein tails. Bacteriophages are examples.have an outer lipid bilayer known as a viral envelope, which is studded with proteins. Influenza and HIV are examples.have many triangular faces. Most have 20 triangular faces and 12 corners. Polio and the papilloma virus are examples.have long narrow capsids shaped liked cylinders. Rabies and ebola are examples. It__eight o'clock now (use form of be) Read the excerpt from The Odyssey.Then I sent out two picked men and a runnerto learn what race of men that land sustained.They fell in, soon enough, with Lotus-Eaters,who showed no will to do us harm, onlyoffering the sweet Lotus to our friendsbut those who ate this honeyed plant, the Lotus,never cared to report, nor to return:they longed to stay forever, browsing onthat native bloom, forgetful of their homeland.Which central idea should be included in a paraphrase of this excerpt?The men sent by Odysseus to investigate the land they had landed upon became forgetful after eating Lotus plants.The Lotus-Eaters meant no harm and simply offered the Lotus plant to Odysseuss men as a gesture of kindness.The Lotus was a sweet plant that made men forget everything except the idea of obtaining and eating more Lotus plants.The men sent ashore by Odysseus were swayed by the hospitality of the Lotus-Eaters and abandoned the idea of returning home. A product owner can measure success by an increase in the team's velocity Solve the following equation by factoring8x-9x-14=0 what is an arithmetic pattern HELP PLEASE I NEED HELP The country with the highest number of bicycle fatalities is . this country has a(n) amount of bicycle usage. the country with the lowest number of bicycle fatalities is . this country has bicycle usage. If savings account interest rates are very low, then every dollar you deposit may earn little or almost no interest. At the same time, increasing prices of consumer goods mean that you can buy less with a dollar tomorrow than you could today. If you choose to save your money instead of spend it, are you actually losing money? Which of the following shows the correct steps to find the value of 27 to the power of 1 over 3 ? (1 point) A. 27 to the power of 1 over 3 equals 9 to the power of 3 to the power of 1 over 3 equals 9 to the power of 3 multiplied by 1 over 3 equals 9 B. 27 to the power of 1 over 3 equals 3 to the power of 9 to the power of 1 over 3 equals 3 to the power of 9 multiplied by 1 over 3 equals 3 C. 27 to the power of 1 over 3 equals 3 to the power of 4 to the power of 1 over 2 equals 3 to the power of 4 multiplied by 1 over 2 equals 9 D. 27 to the power of 1 over 3 equals 3 to the power of 3 to the power of 1 over 3 equals 3 to the power of 3 multiplied by 1 over 3 equals 3