Eating a well balanced diet, participating in regular physical activity, and getting enough slee each night are all practices that support what dimension of wellness?

Answers

Answer 1

Physical well is dimension of wellness being encompasses a number of healthful behaviors inclusive of good enough exercise, right vitamins and abstaining from dangerous behavior which include drug use and alcohol abuse.

It way getting to know approximately and figuring out signs and symptoms of disease, getting ordinary clinical checkups, and protective your self from accidents and harm.Physical size of health: Relates to the green functioning of the frame and its systems, and consists of the bodily ability to carry out responsibilities and bodily fitness.

Social size of health: Being capable of engage with others and take part withinside the network in each an unbiased and cooperative way.There are 5 major elements of private health: bodily, emotional, social, spiritual, and intellectual. In order to be considered "well," it's far vital for none of those regions to be neglected.

Read more about diet;

https://brainly.com/question/8287401

#SPJ4


Related Questions

help please....................​

Answers

Answer:

With???? Where the question at?

Explanation:

Where in the world is (or was) dancing illegal? Why is it illegal to dance there?

Answers

Answer:

New York

Explanation:

the New York City Cabaret Law has prohibited dancing in all spaces open to the public that sell food and/or drink with the exception of those who obtain a cabaret license. This law was still enforced until it was repealed in 2017.

The New York City Cabaret Law was passed in 1926, during the Harlem Renaissance. An attorney and professor challenging the cabaret law wrote that the law originally targeted jazz clubs in Harlem and the social mixing of races

who wants a bbc? females 0nly

Answers

Answer:

no thanks

im good

Answer:

??????

Explanation:

im just here for the points

idek what a bbc is

Today we have more stressers than
stressers.
A. difficult; basic
B. mental; physical
C. controllable; combative

Answers

Answer: B

Explanation:

mental; physical

Which is a primary risk factor for developing cancer?

Answers

Answer:

Cancer risk factors include exposure to chemicals or other substances, as well as certain behaviors. They also include things people cannot control, like age and family history. A family history of certain cancers can be a sign of a possible inherited cancer syndrome.

Explanation:

hope this helps!

Answer: The most common risk factors for cancer include aging, tobacco, sun exposure, radiation exposure, chemicals and other substances, some viruses and bacteria, certain hormones, family history of cancer, alcohol, poor diet, lack of physical activity, or being overweight.

Explanation:

A primary care physician is a doctor who treats many types of illness and injuries. A specialist is a medical professional who has chosen to focus on one field of medicine, such as an oncologist, who treats only cancer, or a podiatrist, who focuses only on treating foot conditions. What are the advantages of seeing a specialist as opposed to a primary care physician? List at least one circumstance in which you might want to see a specialist, and at least one circumstance in which you might want to see a primary care physician.

Answers

Answer:

Explanation:

The advantages of seeing a specialist is because they mastered in one specific type of health problem and can treat that problem well and efficiently, whilst a primary care is to treat many and they may not be able to 100% deal with the problem you are facing.

A circumstance you want to see a specialist is if you have a bleeding/highly wounded internal organ.

A circumstance you want to see a primary care physician is if you have a broken leg or if you have a fever that won't go away.

Parents of infants
(A) provide most of the cues about age-appropriate behaviors.
(B) do most of the self-regulating for babies.
(C) expect children to serve their parents' needs.
(D) are responding to the social and emotional needs of children.

Answers

The answer is D.
Explanation: I’m in an advanced child development class

Type the correct answer in the box. Spell all words correctly. Complete the sentence using the correct term. is the study of muscles.​

Answers

Answer:

Myology

Explanation:

Myology is the study of muscles

1.________________ involves taking air into the body and releasing air into the environment.
Breathing
or

Respiration?

Answers

Should be breathing.
Respiration is more of a chemical process that turns oxygen into carbon dioxide.
Breathing is the action of taking in air

Why is it important to lose unhealthy weight in a healthy way?

Answers

Answer:

so you don't gain the weight back after the weight loss and so you aren't unhealthily overweight.

Explanation:

Answer:why i think it is important to lose unhealthy weight in a healthy why is because if you where to do something like not eat then you could starve yourself to death and that could lead to something that your do not wan't to have happen to you. PLEASE ADD ME AS A FRIEND! MY NAME IS SEBASTIAN FAIRBAIRN

Explanation: i do not know if it is a right or wrong answer.

refers to the number of times per week or how often that a person
participates in physical activity.
Frequency
Intensity
Overload
Duration

Answers

Frequency is what the answer is. (How Frequent you exercise)

Can someone help me plz

Answers

Answer:

B and C

Explanation:

When you are stressed about your homework, don't you tremble and sweat?

brainliest plz

both B AND C are the answers

Two health questions. they have to do with CPR and responsiveness.
How do you establish unresponsiveness?
What do you do if no response?

Answers

Check their pulse on the neck with 2 fingers to see if they’re unresponsive if they are not call the police and start chest compressions

Which of the following could be a reason why a vocational school may not be
for you?
O A. It's difficult to transfer credits.
• B. It is less personal.
• D. It takes longer to complete.

Answers

It is difficult to transfer credits. (A)

Write down what you might say to a friend who is in trouble with drugs and needs to get help

Answers

i’d tell them that they will be happier and feel so much better once they get the help they need and i’d help them slowly get off drugs. if i’m right please give me brainliest bc i need it to rank higher

'Breastfeeding is highly emphasized'. Justify this statement.

Answers

Answer: Breastfeeding is highly emphasized is explained below in complete details in points.

Explanation:
Breast milk benefits keep your baby healthy.
It provides all the essential nutrients in the proper balances.
It defends against diseases, illness, and obesity.
It defends against diseases, like cancer and diabetes.
It protects against diseases, like ear infections.
It is easily absorbed – no constipation, or upset abdomen.
Babies have more robust weights as they progress.
Breastfed babies score higher on IQ tests.

Lesbian, gay,bisexual or transgendered youth are at a decreased rate of being bullied.
Group of answer choices

True

False

Answers

Answer:

False

Explanation:

According to data from the 2015 national Youth Risk Behavior Survey (YRBS), of surveyed LGB students:

10% were threatened or injured with a weapon on school property

34% were bullied on school property

28% were bullied electronically

23% of LGB students who had dated or went out with someone during the 12 months before the survey had experienced sexual dating violence in the prior year

18% of LGB students had experienced physical dating violence

18% of LGB students had been forced to have sexual intercourse at some point in their lives. And acording to an article from the cdc, when lgtbq+ children are exposed to bullying it can not only have a negitive impact on the child themselves, but i can also have an impact on their learning. Hope this helps

false it has increased slog

PLZZ ANSWER DUE IN 1 MIN

The front of the door to Rueben’s classroom is a
rectangle with an area of 2,688 square inches.
If the width of the front of the door is 32 inches,
what should be the measure of the height?

Answers

Answer:

84 inches

Explanation:

2688/32 =84

Answer:

How nice of u doing ur work at the last minute lol

Explanation:

A mentoring program was set up for new hospital staff. The purpose of the mentoring program is to
O build working relationships.
O establish an authoritarian leader.
foster competition and improve policy.
O increase delegation of roles.

Answers

A mentoring program was set up for new hospital staff. The purpose of the mentoring program is to build working relationships.

The correct answer to the given question is option A.

A mentoring program is a way to introduce new hires to the workplace and help them adjust to the working environment. The program can assist in the development of communication skills, learning how to take direction, understanding organizational norms and culture, and building self-confidence.

The mentoring program was designed to build relationships between new hospital staff and more seasoned hospital staff.Mentorship is beneficial to both new and experienced employees in healthcare settings.

Mentoring relationships should be positive and professional in order to ensure success. New staff members may feel lost and overwhelmed when starting in a new workplace, and a mentor can help them adjust to the environment more quickly. Mentors can help new employees by providing guidance, advice, support, and encouragement.

Additionally, mentors can provide feedback on their progress and offer suggestions for improvement.A mentoring program fosters open communication, the establishment of strong relationships, and the sharing of knowledge. It is crucial to have a mentoring program in place to help new staff members adapt and integrate successfully into the organization. A mentoring program helps establish strong working relationships, which is essential for any organization's success.

For more such questions on mentoring program, click on:

https://brainly.com/question/6598147

#SPJ8

What mindset are you? Do you think this is accurate? Why or why not?

Where in your life can you recognize fixed mindsets?

Where are you growth-minded?

Answers

Yesssssssssss Jesus good

When taking medication, you should always __________. A. tell your doctor about other medication you may be taking B. stop immediately after the symptoms disappear C. take as much as needed to feel better D. refer to online resources for dosage recommendations Please select the best answer from the choices provided. A B C D

Answers

Answer: A

Explanation: Your doctor knows more about you then some online information, you should always tell your doctor about other medications that you are taking and you can ask your doctor for more information.

Answer:

I think the answer is A

The answer cant imply letter D because you can't trust all resources from the internet. I think it is A because your doctor knows about you and they can help you out with the other meditation you will be taking.

Counselors give people feedback about?
their behavior, body language, facial expressions.
the details of their family history.
the appropriateness of their goals.
their ability to summarize and paraphrase.

Answers

Answer:

i think its a

Explanation:

Perspiration is a symptom of a heart attack.
True or false

Answers

Answer:

true.

Explanation:

Sweating profusely when you don't have a fever and are not exerting yourself or in a hot environment – especially if accompanied by other symptoms such as lightheadedness, shortness of breath nausea, or chest pain – may be a symptom of a heart attack.

Answer:

Explanation:

Yes, what Perspiration means is to sweat. Sweating is very normal when you have a heart attack. So true

PLLLZZ HELLLPPP DUUUE IN 1 MINNN

A bush pilot was asked to fly the perimeter of a
state park to look for black bears. The state park
is a rectangular shape 20 miles wide and 32 miles
long. What is the perimeter of the state park?
A 52 miles
B 104 miles
C 320 miles
D 640 miles

Answers

Answer:

D 640

Explanation:

you multiply length(32) time width(20)

and it gives u 640

The correct answer is D 640 miles

How does one earn in this app???​

Answers

Answer:

answer other people's questions and ask questions:>

Answer and ask questions

i can be stored as a long term source of energy. what macronutrient am i?

PLEASE HELP!!

Answers

I think it’s carbohydrates not really sure though
carbohydrates!! if i’m right please give me brainliest bc i need it to rank higher

Explain the process of ejaculation 1,2,3,4,5,

Answers

Answer:

Ejaculation takes place in two phases: in the first, or emission, stage, sperm are moved from the testes and the epididymis (where the sperm are stored) to the beginning of the urethra, a hollow tube running through the penis that transports either sperm or urine; in the second stage, ejaculation proper, the semen is moved through the urethra and expelled from the body.

Explanation:

Ejaculation is a physiological process heavily controlled by the autonomic nervous system. It consists of two main phases: emission and expulsion.

Answer as Many Questions as You Can! ( I'll mark u brainliest)
To stay in good physical condition you should always eat
A)food high in salt
B)complex carbohydrates
C)meat and other proteins
D)plain nourishing foods that make up a balanced diet
Who famously said, “In the United States, we do not want a nation of spectators but a nation of participants in the vigorous life.”
A)President Obama
B)Your PE teacher
C)President Kennedy
D)The Dalai Lama
E)Oprah Winfrey
Pilgrims thought sports and play were the work of the devil. Some recreational sports did exist, however. Choose the activities that were allowed during this time period. (Check all that apply)
A)skating
B)skiing
C)skeet shooting
D)horse racing
E)bowling

Answers

Answer:

To stay in good physical condition you should always eat

D)plain nourishing foods that make up a balanced diet

Who famously said, “In the United States, we do not want a nation of spectators but a nation of participants in the vigorous life.”

im not sure I think it MIGHT be: A)President Obama

Pilgrims thought sports and play were the work of the devil. Some recreational sports did exist, however. Choose the activities that were allowed during this time period. (Check all that apply)

D)horse racing

E)bowling

(im not 100 sure about this answer) it was hard, I see y u asked for help

Exercise slows down the activity of which type of muscles?

Answers

Answer:

Such activities rely mainly on Type I (slow-twitch muscles) which sustain maximal contraction for extensive periods of time. This use of slow-twitch muscles, and the availability of oxygen, prevents the buildup of lactic acid, and typically does not result in substantial muscle fatigue in the short-term.

Explanation:

Withdrawing from virtual technology abuse and not attempting to tell anyone or resolve the issue is called Mediation.
Group of answer choices

True

False

Answers

Answer:

i believe that the answer is false

Explanation:

Other Questions
Which describes the translation of ABCD to A'B'C'D'.A)translation 3 units right and 6 units uptranslation 6 units right and 3 units uptranslation 3 units left and 6 units downD)translation 6 units left and 3 units down What is another vocabulary word for slope? I need help ASAP!!A.DB.BC.CD.A ms. lorenz needs to rent a car for 3 days. she can choose from two plans. plan a costs $60 per day. plan b costs $30 per day plus $.40 for each mile she drives. ms lorenz decides that plan b will cost her less than plan a. write and solve an inequality to represent the number of miles, m, that ms. lorenz expects to drive. PLEASE HELP!!! Pools are not selling well at Jays Store. So, he decides to put them on clearance for $19.99, plus an extra 20% off. Approximately how much will the small pool cost? Give me a brief summary of the middle age era of music? Find the mussing numbers13315+ ****24 305 Matt decides the length of his table will be 15 in. He calculates that the area of the table is 30 in. squared. Determine if Matts calculation is correct what do ducks short necks help them to do? pls help :/ A piece of fabric 4 meters long is cut into two pieces. One piece is 1.25 meters long. How much longer is the second piece of fabric? How do religious and ethnic groups both reflect and influence the geography of places at differentscales? You must use a number line!n + 5 > 13PLZ HELP ILL PUT BRAINLIEST What is the measure of arc QSR? Use the drop-down menus to complete these sentences.The running of a set of programming instructions multiple times is called .If a sequence of code is repeated multiple times, it is referred to as .One set of coding instructions processing many different sets of data and eliminating multiple lines of code is an example of An item on sale costs %50 of the original price. The original price was 45$.Find the sale price.Please help! I will give the brainiest! 9.5/19=x/30 solve the proportion Where are Gold, Limestone and kaiolin found. PLEASE HELP NO LINKS IM TIMED 1/2 x 1 3/5 to the simplest form Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG Match the words in the left column to the appropriate blanks in the sentences on the right. The secondary structure given in the MaxExpect results can best be described as_________ Thus, the type of RNA is best classified as_________ a single strand with a distinctive cloverleaf structure a single-stranded random coll an unspecified type of RNA rRNA a single strand folded upon itself to form a small, round structure tRNA