Given that cos(θ)= -√3/4 and tan(θ) > 0, find sin(θ)

Given That Cos()= -3/4 And Tan() > 0, Find Sin()

Answers

Answer 1

Answer:

B. -√13/4

Step-by-step explanation:

cos 0 = -√3/4 => x=-√3 , h=4

tan 0 > 0

y should be on quadrant III

y= √4²-3= √16-3=√13 => -√13

so, sin 0 = y/h = -√13/4

Answer 2

Answer:

B. -√13/4

Step-by-step explanation:

:)


Related Questions

Important: (Worth 50 Points)

The number of adults at an amusement park, measured in hundreds of people, is represented by the function a(w)=−0.4w2+5w+9, where w is the number of weeks since the amusement park opened for the season.

The number of children at the same amusement park, measured in hundreds of people, is represented by the function c(w)=−0.2w2+9w+12, where w is the number of weeks since the amusement park opened for the season.

What function, f(w) , can be used to determine how many more children than adults are at the amusement park any week during the season?


f(w)=−0.2w2+4w+3

f(w)=−0.2w2+4w−3

f(w)=0.2w2+4w+3

f(w)=0.2w2+14w+3

Answers

Answer:

C. f(w) = 0.2w² + 4w + 3

Step-by-step explanation:

The function f(w) is the difference of c(w) and a(w):

f(w) = c(w) - a(w) = − 0.2w² + 9w + 12 - (- 0.4w² + 5w + 9) =− 0.2w² + 9w + 12 + 0.4w² - 5w - 9 =0.2w² + 4w + 3

Correct choice is C

David bought a chain of fast food restaurants that operated 200 stores in 2009. The number of restaurants has grown at a rate of 12% annually

Answers

Complete Question

David bought a chain of fast food restaurants that operated 200 stores in 2009. The number of restaurants has grown at a rate of 12% annually.how many stores does the restaurant operate in 2020?

Answer:

[tex]N_{11} \approx 749[/tex]

Step-by-step explanation:

From the question we are told that:

Number of Fast Food Restaurants [tex]P=200[/tex]

Number of years [tex]t=11yrs[/tex]

Rate [tex]r=12%[/tex]

Generally the equation for the Number of restaurant in operation in 2020 is mathematically given by

 [tex]N(t)=Pe^{rt}[/tex]

Therefore

For t=11

 [tex]N_{11}=200*e^{0.12*11}[/tex]

 [tex]N_{11}=748.7[/tex]

 [tex]N_{11} \approx 749[/tex]

which veal represents the functions ?
A. graph A only
B. graph D only
C. graph B and graph D
D. graph C and graph D

Answers

hola quien habla español bueno ya no Adios :)

Answer:

C.(B and D

Step-by-step explanation:

Pleaseee HELP ASAP !!!

Answers

Your answer is going to be b

Answer:

A: (x-5.5)^2 + (y-4)^2=12.25

Step-by-step explanation:

Create your proportions using the form to represent the flowing problem seven is what percent of 30?

Answers

Answer:

23.33%

Step-by-step explanation:

Let

x = percentage

Base = 30

Amount = 7

x% of 30 = 7

x/100 * 30 = 7

(x*30) / 100 = 7

30x / 100 = 7

Cross product

30x = 100 * 7

30x = 700

x = 700/30

x = 23.333333333333

Approximately,

x = 23.33%

how many and what type of solutions does 5x^2-2x+6 have

Answers

Answer:

two irrational solutions

Step-by-step explanation:

you can use the quadratic formula:  (b ± √b²- 4ac)÷2a

a = 5, b = -2, c = 6

= [2 ± √(-2²)-4(5)(6)] ÷ 2(5)

= (2 ± √4-120) / 10

two complex solutions:  (2+√-116)/10, (2-√-116)/10


[tex] \sqrt] a3 - b3[/tex]
what is answer

Answers

Answer:

y=3-b linear function

Step-by-step explanation:

In August 200920092009, Usain Bolt ran 100100100 meters in 9.589.589, point, 58 seconds (\text{sec})(sec)(, start text, s, e, c, end text, ), setting the world record at that time. There are approximately 1.0941.0941, point, 094 yards (\text{yd})(yd)(, start text, y, d, end text, )in a meter. What was Usain Bolt's average speed in yards per second

Answers

Answer:

Record speed of Usain Bolt in yards per second = 11.42 Yards (Approx.)

Step-by-step explanation:

Given:

Record speed of Usain Bolt = 100 meter in 9.58 second

1 meter = 1.094 yards

Find:

Record speed of Usain Bolt in yards per second

Computation:

Record speed of Usain Bolt = 100 meter in 9.58 second

1 meter = 1.094 yards

100 meter = 1.094 × 100 yards

100 meter = 109.4 yards

Record speed of Usain Bolt in yards per second = 109.4 / 9.58

Record speed of Usain Bolt in yards per second = 11.4196

Record speed of Usain Bolt in yards per second = 11.42 Yards (Approx.)

Please help with this question.

Answers

Answer:

The value of "h" = 32 unit

Step-by-step explanation:

Given:

In given parallelogram

Height for base 36 = 24

Height for base 27 = h

Find:

The value of "h"

Computation:

Area of parallelogram = Base x Height

For base 36

Area of parallelogram = 36 x 24

Area of parallelogram = 864 unit²

For base 27

Area of parallelogram = 27 x h

864 = 27 x h

The value of "h" = 864 / 27

The value of "h" = 32 unit

Give the name (monomial,
binomial, trinomial etc.) and
degree of the polynomial.
15x2

Answers

ANSWER

Step-by-step explanation:

EXAMPLESmonomial:-20ybinomial:-25x+70ytrinomial:-13x+17y+√16Degree of polynomial of 15x^2 is

DEGREE =2

does 3 noncollinear lines always from a triangle?

Answers

Answer:

Three non-co-linear points determine a circle. Three non-co-linear points determine a triangle only if you assume that each pair of these points determines a line which is a side of the triangle. Then, the three points will be the vertices of the triangle.

If you do not have this constraint, so that each line that forms a side of the triangle need pass through only one of the three points, then the three points will not determine a particular triangle

Solve for x. assume that lines which appear tangent are tangent. x=

Answers

Answer:

x = 8

Step-by-step explanation:

The product of the length of the exterior segment of a secant and the length of the secant is equal to the correpsonding operation with the other secant.

9(9 + 11) = 10(10 + x)

180 = 100 + 10x

10x = 80

x = 8

Darla is painting a mural. She needs to paint a rectangular stripe that measures 1 half yard by 6 yards. Which is the area of the stripe?

Answers

Answer:

3 yards^2

Step-by-step explanation: Area of a rectangle=Length*Width. 6 yards*0.5 yards=3 yards^2

Ли делать операцию на сердце тяжело быть звездой матча в чемпионате страны и в этом году я в шоке с тебя в голове не укладывается в голове и в этом случае можно и нужно ли это было так хорошо начиналось все это не ! :)

Multiply using suitable properties: 7219 x (-1005)

Answers

-7255095 is the ans in think so

Can y’all help me ASAP please?

Answers

Step-by-step explanation:

[tex]8 log_{5}( {x}^{5} ) = 8 \times 5 log_{5}(x) \\ = 40 log_{5}(x) [/tex]


The equation of the line that has a slope and passes through the point (-1, -3) is 3x + 2y +3 = 0.

Answers

Answer:

below

Step-by-step explanation:

that is the procedure above

Bab isn’t good with quick mafs

Answers

Answer:

153.86

Step-by-step explanation:

Formula area circle = πr²

Solve:

Area = 3.14* 7²

Area = 3.14 * 49

Area = 153.86

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

Find the volume of the cone.
Either enter an exact answer in terms of π or use 3.14 for π and round your final answer to the nearest hundredth.

Answers

Answer:37.68

Step-by-step explanation:

Do yk the anwser to my question?

Scarlett can bake 10 cookies with each scoop of flour. Write an equation that shows the relationship between the scoops of flour x and the cookies y. Write your answer as an equation with y first, followed by an equals sign.

Answers

y = 10x

Where y is equal to the amount of cookies and x is the scoops of flour.

ABCD is a parallelogram in which cd = 7cm Ad = 5cm ND adc = 125.. Find correct to one decimal place the area of the parallelogram.

Answers

Answer:

28.7cm²

Step-by-step explanation:

The sketch of the parallelogram is attached to this response.

As shown in the sketch,

h is the height of the parallelogram

ADC is 125°

AD = 5cm

CD = 7cm

Also

Since the adjacent angles of a parallelogram are supplementary (add up to 180°), it means that;

=> ADC + BCD = 180°

=> 125° + BCD = 180°

=> BCD = 180° - 125°

=> BCD = 55°

The area (A) of a parallelogram is given by;

A = b x h            ----------(i)

Where

b = base of the parallelogram

h = height of the parallelogram

From the sketch,

b = CD = 7cm

h can be found by using the sine trigonometric function as follows

sin BCD = [tex]\frac{h}{BC}[/tex]

=> sin 55° = [tex]\frac{h}{5}[/tex]

=> h = 5 sin 55°

=> h = 5 x 0.8192

=> h = 4.096cm

Now, substitute the values of h and b into equation (i) as follows;

A = 7 x 4.096

A = 28.672

A ≅ 28.7 (to one decimal place)

Therefore, the area of the parallelogram is 28.7cm²

5.88 pts
> A statue of George Washington is in Druid Hill Park. Elliot stands 16 ft away from the
statue, and places a mirror 12 ft from the statue (4 ft from his feet). He can see the
top of the statue in the mirror. If Elliot's height is 6 ft. How tall is the statue?
O 2 ft
O 18 ft
0 24 ft
O 8 ft

Answers

Answer:

18 ft

Step-by-step explanation:

Similar triangles are proportional

Ratio of vertical legs  = Ratio of base legs

x/6 = 12/4

multiply both sides by

x = 12/4 * 6

x = 18 ft

4x +y = 10 graph the linear equation​

Answers

Graph not attached, linear equation: y=-4x+10

why does reflexive property exist

Answers

The reflexive property can be used to justify algebraic manipulations of equations.

FAST PLEASE
A standard deck of 52 playing cards contains 13 cards in each of four suits: hearts, diamonds, clubs, and spades. Four cards are drawn from the deck at random. What is the approximate probability that exactly three of the cards are diamonds? 1% 4% 11% 44%

Answers

Answer:  B)  4%

=====================================================

Explanation:

We'll involve the nCr combination formula here. This is because order doesn't matter.

There are n = 13 diamonds and we want to select exactly r = 3 of them.

So,

[tex]_n C _r = \frac{n!}{r!*(n-r)!}\\\\_{13} C _{3} = \frac{13!}{3!*(13-3)!}\\\\_{13} C _{3} = \frac{13!}{3!*10!}\\\\_{13} C _{3} = \frac{13*12*11*10!}{3!*10!}\\\\_{13} C _{3} = \frac{13*12*11}{3!}\\\\_{13} C _{3} = \frac{13*12*11}{3*2*1}\\\\_{13} C _{3} = \frac{1716}{6}\\\\_{13} C _{3} = 286\\\\[/tex]

There are 286 ways to pick the three diamond cards. Then there are 52-13 = 39 ways to pick the fourth card that is either a spade, club of heart.

So we have 286*39 = 11,154 ways to pick the four cards given the conditions your teacher set.

This is out of 52C4 = 270,725 ways to pick four cards (use the nCr formula above with n = 52 and r = 4).

Divide the two values to get the answer:

(11,154)/(270,725) = 0.04120048019208

that rounds to 0.04 which converts to 4%

So there's roughly a 4% chance of getting exactly 3 diamond cards.

Answer:

4% (four percent)

A coach writes the batting order of his starting 9 out of the team of 20 on a piece of paper. How many different ways could the list be written?

Answers

Answer:

Total number of orders = 77,520

Step-by-step explanation:

Given:

Number of students on team = 20

Number of students on the starting line =9

Find:

Total number of orders

Computation:

Total number of orders = 20! / [20 - 7]!(7!)

Total number of orders = 20! / [13]!(7!)

Total number of orders = [20 x 19 x 18 x 17 x 16 x 15 x 14] / [7 x 6 x 5 x 4 x 3 x 2 x 1]

Total number of orders = 77,520

The number of different ways that the list can be written will be 167,960.

What are permutation and combination?

A permutation is an act of arranging items or elements in the correct order. Combinations are a way of selecting items or pieces from a group of objects or sets when the order of the components is immaterial.

A coach writes the batting order of his starting 9 out of the team of 20 on a piece of paper.

The number of different ways that the list can be written will be

²⁰C₉ = 20! / [(20 - 9)! x 9!]

²⁰C₉ = 20 x 19 x 18 x 17 x 16 x 15 x 14 x 13 x 12 x 11! / (11! x 9 x 8 x 7 x 6 x 5 x 4 x 3 x 2 x 1)

²⁰C₉ = 167,960

The number of different ways that the list can be written will be 167,960.

More about the permutation and the combination link is given below.

https://brainly.com/question/11732255

#SPJ2

A guitar is originally priced at $80. The online retailer gives a discount and the guitar is now priced at $44. Enter the percentage discount for the cost of the guitar. (PLEASE ANSWER THIS I NEED THE ANSWER BY TODAY RIGHT NOW!!!)

Answers

Answer:

The percentage discount for the cost of the guitar is 45%.

Step-by-step explanation:

First let's find the difference between the original price and the new price.

80 - 44 = 36

So the actual discount got the price down by $36.

To find the percentage discount we need to ask ourselves the question

36 is what percent of 80?

36 = X percent of 80

In math, of means multiply.

36 = X percent * 80

So to get the "X percent" part alone we divide by 80 on both sides.

36 divided by 80 = 0.45

36 is 45 percent of 80.

The percentage discount for the cost of the guitar is 45%.

8 books cost 11.20. Find the cost of 5 books

Answers

First of all we have to find the cost of a book then multiply it by 5 :

$ 11.20 ÷ 8 = $ 1.4

$ 1.4 × 5 = $ 7

Thus 5 books have a cost of $ 7 .

Answer:

The cost of 5 books is $7

Step-by-step explanation:

If there are 8 books and you need to find the cost of 5, you need to first find the cost for one book.

If 8 books cost 11.20.

11.20 ÷ 8 = 1.40

1.40 is the cost of one book

1.40 x 5 = 7

So the cost of 5 books is $7

I tried my best to explain

need help with thisss

Answers

9514 1404 393

Answer:

  cos(x) = 0.6

Step-by-step explanation:

First, we need to find UQ.

  UQ = UP·cos(y°) = UP·√(1 -sin²(y°)) = (26 cm)√(1 -25/169) = (26 cm)(12/13)

  UQ = 24 cm

Then TQ is ...

  TQ = 1/3UQ = 1/3(24 cm) = 8 cm

And cos(x°) is ...

  cos(x°) = √(1 -sin²(x)) = √(1 -64/100)

  cos(x°) = 6/10 = 3/5

  cos(x°) = 3/5 = 0.6

In the diagram below, A ABC DEF
Which sequence of transformations maps A ABC onto A DEF.

Answers

Answer:

basically the opposite

Step-by-step explanation:

its inverted therefore find out how to get c b a and boom

What is the probability of getting 1 red and then blue?

Answers

Answer:

Find the volume of this prism.

Other Questions
Which lists all the lines that are parallel to line s? Can someone explain this to me. am i supposed to input the x=4 into each X spot or what??? please help thank youuuu Please help I will give you Brainlyest HelpHelpHelpHelpHelpHelp Write two simple sentences about education a/ one sentence using one subject and two verbs b/ one sentence using two subjects and two verbs Peter work three more days than jill. Peter earn $20 day jill earn $40 day. But they earned the same amount of money Which of the following is an equivalent trig ratio for tan 28Cos 621/ tan 621/ tan152Cos 28 The answer choices are spelling rules about what to do before adding suffixes to a base word that ends in a consonant. Identify the rule that was applied to the word below.benefit + -ingDo not double the final consonant if the suffix begins with a consonant.If a base word has three or more syllables, do not double the final consonant.If a base word ending in one consonant has two syllables, and the second syllable gets the accent, double the final consonant.If a base word ends in more than one consonant, just add the suffix without changes.If a base word has only one syllable and ends in one consonant, double the final consonant.If a base word ending in one consonant has two syllables, and the first syllable gets the accent, do not double the final consonant. two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?A whether the producers are located on land or in waterB whether or not the food web includes tertiary consumersC whether the web includes animals that migrate during the yearD whether the ecosystem described by the web is localized or very broad two particles woth each charge magnitude 2.010^-7 c but opposite signs are held 15cm apart.what are the magnitude and direction of the electric field E at tge point midway between charges Subordinate Conjunctions make a _______ clause not be able to stand on its own. PLEASE HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP please help please help the tRNA for GUCAUCGAUCGAUCGGAUGCC A red light flashes every 6 seconds A yellow light flashes every 4 seconds They both flash at the same time.After how many seconds will they next both flash at the same time? The radius of a right circular cone is increasing at a rate of 1.1 in/s while its height is decreasing at a rate of 2.6 in/s. At what rate is the volume of the cone changing when the radius is 107 in. and the height is 151 in. The elements in a long array of integers are roughly sorted in decreasing order. No more than 5 percent of the elements are out of order. Which of the following is the best method to use to sort the array in descending order?I. Insertion sort.Il. Merge Sort.III. Heap Sort.a. Ill only.b. I only.c. II and III only.d. I and II only.e. Il only I and.f. Ill only. Help please I asp !!! For A = R + PRT/100 make P the subject. 1. What are metabolic wastes?2. Which are the main organs of the excretory system?