How is the life cycle of Ascomycetes different from that of humans?

A.
Haploid cells undergo meiosis.

B.
Haploid cells undergo mitosis.

C.
Diploid cells undergo meiosis.

D.
Diploid cells undergo mitosis.

How Is The Life Cycle Of Ascomycetes Different From That Of Humans? A. Haploid Cells Undergo Meiosis.
How Is The Life Cycle Of Ascomycetes Different From That Of Humans? A. Haploid Cells Undergo Meiosis.

Answers

Answer 1

Ascomycetes have a different life cycle from humans in that they go through mitosis in haploid cells.

How do haploid cells work?

A cell with a single collection of chromosomes is called haploid. The complement of chromosomes found in sperm or egg cells, often known as gametes, is also referred to as haploid. In humans, sperm and eggs are haploid cells with 23 chromosomes—one of each chromosomal pair found in diplod cells—and are hence haploid.

What are the benefits of haploid cells?

Haploid cells are ideal for studying gene function because they only have one copy of something like the genome, making it impossible for changes to be hidden from view. Humans make haploid cells during meiosis.

To know more about haploid cells visit:

https://brainly.com/question/1542757

#SPJ1


Related Questions

Practice Labeling the Cell. Label the parts of each cell.​

Answers

Hhikmberuujbbbbbbbbvv

Where should sinks be available for food service
workers?
Outside the food preparation sink
Separate sink located in the food preparation
area
.
Inside the customer bathroom
a
In the employee breakroom

Answers

Answer:

for me I think

Explanation:

In the employee break room

B.
Compare the following animals.
1. snake and lizard
2. fish and eel
3. dove and duck​

Answers

Answer:

This is easy

Explanation:

1. They are both reptiles.

2. They are both fish.

3. They are both birds.

Examine the diagram. A specific location on Earth is identified by
the letter X.
Which of the following is an accurate description of the Earth's
location by the letter X?

Answers

Answer:

The answer is helping hands

1) What are estuaries? 2) How/why do shallow estuary waters create unique habitats for organisms living here? 3) How does the salinity in water change as you move from inland areas out towards the ocean? Be sure to include the phrase "brackish waters" in your response . 4) List 4 ways estuaries provide protection for inland areas. 5) How does dredging impact fish living in an estuary? 6) How could too many nutrients impact the natural balance in an estuary? 7) List and describe 3 ways the land terrain change as we move from Charlotte, NC to the coastal plains of North Carolina ) List 4 ways estuaries provide protection for inland areas. 9) List 5 factors that can change the flow of water through an ecosystem 10)List and describe 4 reasons estuaries are important for both wildlife and human activity

Answers

Answer:

Estuaries is a water body where freshwater from rivers and streams combines with salt water that is coming from the ocean.

Explanation:

Estuaries is a type of water body that is partially enclosed present at the coastal side where freshwater from rivers and streams combines with salt water that is coming from the ocean. Shallow estuary waters create unique habitats for organisms living there because the presence of brackish water refers to the mixture of fresh water draining from the land and salty seawater. The salinity in water change as you move from inland areas out towards the ocean because the water of inland has less salt in it while water of ocean has huge amount of salt present in it so when we move from inland to the ocean salt concentration increases in it. estuaries provide protection for inland areas by filtering pollutants, prevent shoreline erosion, flooding and storm.

endosymbiosis theory

Answers

Answer:

The endosymbiotic theory states that some of the organelles in eukaryotic cells were once prokaryotic microbes.

Some species of sea turtles can live for hundreds of years. Which prediction regarding these species is MOST likely true?

A.
Telomerase is not expressed in their cells.

B.
Chromosomes do not replicate as they grow.

C.
Telomere length does not shorten as they age.

D.
Genes are not located near the ends of their chromosomes.

Answers

D.

Genes are not located near the ends of their chromosomes.

After the telomeres disapear the important genetic material won't be affected.

Answer:

C. Telomere length does not shorten as they age.

Explanation:

A is wrong because Telomerase is expressed in their cells.

B is wrong because chromosomes do replicate as they grow.

D is wrong because the genes are located near the ends of the chromosomes.

I took the test.

correct the statment​

Answers

Shoots are called crown of the tree

are all qnswer right​

Answers

Answer:

yes good job!

Explanation:

Answer:

Explanation:

Yes great job

[____________] is the material or energy that goes into a system

Answers

Answer:

Solar energy

Explanation:

10 points
If the pH is adjusted to around neutral, most of the essential nutrients
(elements) will become available for uptake by the plant.
True
False

Answers

Soil pH affects nutrients available for plant growth. In highly acidic soil, aluminum and manganese can become more available and more toxic to plant while calcium, phosphorus, and magnesium are less available to the plant. In highly alkaline soil, phosphorus and most micronutrients become less available.
The answer your looking for is true I believe

Competition occurs when organisms try to use the same limited resource. True or False

Answers

Answer:

the answer is

true and this organism are called

inter specific organism

PLSSSS HELPPPP ASAPPP

Answers

Answer:

the green 1

Explanation:

A young woman suffered from a severe injury to her pelvic cavity. What potential problem would her doctors be most
likely concerned about?

Answers

Answer:

diffuculty having childern

This neurotransmitter is an antagonist.
acetylcholine
both
GABA
neither
which one?

Answers

Answer:

acetylcholine

Explanation:

Acetylcholine is an organic chemical that functions in the brain and body of many types of animals as a neurotransmitter—a chemical message released by nerve cells to send signals to other cells, such as neurons, muscle cells and gland cells

Mark me as brainliest

For the proteins you researched, how does the structure help the protein perform its function?

Answers

Answer: Protein structure depends on its amino acid sequence and local, low-energy chemical bonds between atoms in both the polypeptide backbone and in amino acid side chains. Protein structure plays a key role in its function; if a protein loses its shape at any structural level, it may no longer be functional.

Hope this helps.... Stay safe and have a Merry Christmas!!!!!!! :D

The relationship between the structure and function of proteins is complex. The way a protein interacts with other molecules in the cell depends on the precise arrangement of amino acids and the resulting three-dimensional form.

For example, the structure of a protein's active site enables it to bind to particular substrates and act as an enzyme by catalyzing chemical reactions. Signals can be transmitted by receptor proteins because of their binding sites, which fit into particular molecules like keys to a lock. Collagen and other structural proteins form the fibrous network that gives strength and support to tissues.

Molecules can travel across membranes more easily thanks to unique channels or binding sites on transport proteins. A protein's stability, folding and ability to carry out its intended function all depend on its overall structure.

Learn more about Proteins, here:

https://brainly.com/question/30986280

#SPJ4

How many membranes are does the nucleus have?

Answers

Explanation:

The nucleus contains all of the genetic material for a eukaryotic cell, but this genetic material needs to be protected. And it's protected by the nuclear membrane, which is a double membrane that encloses all the nuclear genetic material and all the other components of the nucleus

Answer:

it has 2

Explanation:

I need help asap pls!!

Answers

C. I think your best bet would be C because they are the only ones that have at least one thing in common with each other

Answer:

it would be c because the order are the same on both

Which statement about the food chain is correct?
A.
The Harpy Eagle obtains chemical energy from the Sun.
B.
The Red-eyed Tree Frog obtains chemical energy from the Squirrel Monkey.
c. The Coconut Trees obtain light from the Sun and convert it into chemical energy.
D. The Squirrel Monkey obtains chemical energy from the Grasshopper.



Answers

C. That’s the answer that makes the most sense to me. Hope that helps! =D

Answer: Letter C

Explanation: It is true trees convert the sunlight into chemical energy in a form they could use.

Do turkeys get sleepy from that thing in turkey that makes you sleepy?

Answers

Answer:

Turkey allegedly causes drowsiness because it is packed with a nutrient called tryptophan. Tryptophan is one of 20 naturally occurring amino acids—the building blocks of proteins. Because the body is unable to manufacture tryptophan on its own, it must be obtained from food protein.

Eating anything healthy and filling will get you sleepy

How many chromatids are found in this nucleus?
Six chromosomes in metaphase are shown. They resemble the letter X with red dots in the center.
A.
3

B.
6

C.
12

D.
24

Answers

Each chromosome has 2 chromatids so 2*6=C.12 chromatids

Answer:

C. 12

Explanation:

Each chromosome has 2 legs called chromatids. There are 6 chromosomes, so 6*2 = 12.

To test the validity of their data, scientists take what actions?

A. Repeat original experiments

B. Look for agreement in scientific journals

C. Form teams

D. Devise new experiments

Answers

NnnnnnnkrkkorrjrbrnrjnrrjhddhhejeeBINGO WINGS
A. Repeat original experiments
And or c. Form teams

Depending on how many answers you need

When will an insect that undergoes incomplete metamorphosis develop a set of wings?


a.
after its final molt


b.
when it becomes a pupa


c.
when it breaks out of its chrysalis


d.
only insects that undergo complete metamorphosis have wings

Answers

Answer:

The answer is D not sure

Explanation:

Like those of several other insect species, the stages of growth that the nymph cricket undergoes are referred to as "instars." Crickets usually go through eight to 10 instars before reaching adulthood, which takes about two to three months. Crickets start to develop wings at about 1 month of age.

Which TWO digestive juices are secreted into the duodenum? ​

Answers

Answer:

Liver, and Pancreatic Bile.

Explanation:

Hope this helps. :)

Answer:Pancreatic juice is secreted by the pancreas. It contains proenzymes- trypsinogen, chymotrypsinogen and procarboxypeptidase and enzyme elastase. All these are concerned with digestion of proteins. Trypsinogen is the constituent which is poured into the duodenum in humans. Or it might be Pancreatic juice is secreted by the pancreas. It contains proenzymes- trypsinogen, chymotrypsinogen and procarboxypeptidase and enzyme elastase. All these are concerned with digestion of proteins. Trypsinogen is the constituent which is poured into the duodenum in humans.

Explanation:

These pellets are not eliminated as _________________, but are regurgitated through the ___________________.

Answers

Answer:

These pellets are not eliminated as feces, but are regurgitated through the mouth. Pellets are not found exclusively within the owl families. There are many species of birds known to regurgitate pellets: hawks, eagles, kites, harriers, falcons, and even robins are some of the more familiar ones.

tell me if im wrong :/

Capillaries are blood vessels that *

A.) deliver blood to the cells of the body

B.) contain striated muscle

C.) carry blood toward the heart

D.) readily exchange materials between the blood and body cells

Answers

Answer:

D.

Explanation:

The primary function of capillaries is the exchange of materials between the blood and tissue cells.

When there is a relationship between
two factors it is called a–
a. correlational effect.
b. positive feedback.
c. negative feedback.
d. causal effect.

Answers

C.just leave the relationship alone

which graph best shows the motion of a car stopped at a pedestrian crossing?​

Answers

I’m thinking it maybe be I or C because the car was moving but is currently stopped

What type of fatty acid has one or more double bonds in its molecular structure?

A. Unsaturated

B. Saturated

C. Cream

D. Butter

Answers

Answer:

A. Unsaturated

Explanation:

Fatty Acids: Saturated fatty acids have hydrocarbon chains connected by single bonds only. Unsaturated fatty acids have one or more double bonds. Each double bond may be in a cis or trans configuration.

Got it from google

Where would an explosive volcano MOST LIKELY occur?
A) in the middle of a large plate of earth
B) where plates are coming apart
C) near the edge of a large plate of earth
D) where large plates of earth are colliding​

Answers

Answer:

d

Explanation:

Other Questions
Can you help me plz? Write an equation in point-slope form for the line through the given point with the given slope(8,-3);m= -1/4 a drum has a diameter of 18 in and is 16 in deep find the volume What is the special rule with multiplying or dividing an equality by a negative number? (Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line?