I have a pen
I have a apple
what do I have now?

Answers

Answer 1

Answer:

You have an apple pen. :)

Answer 2

Answer:

I have a pen

I have a apple

apple pen

Explanation:


Related Questions

A golf ball hit off a tee on level ground, lands 62 m away 3.0 later. What was the initial velocity of the golf ball?

Answers

62×3.0

think so not sure

The amount of time for a synchronous input to a flip-flop to be stable before the rising edge of clock is called the hold time. a) True b) False

Answers

Answer:

true

Explanation:

Answer:

true

Explanation:

A 20kg rock is sliding on a rough, horizontal surface at 8 m/s and eventually stops due to friction. the coefficient of kinetic friction between the rock and the surface is 0.200. what average power is produced by friction as the rock stops?

Answers

Answer:

156watts

Explanation:

M = 20

U = 0.200

Vo = 8.0

We are to get p

P = w/t

W = 1/2(vf²-Vo²)

The final velocity is 0

W =-1/2*20*8²

= -640J

Acceleration = -ug

= -0.200*9.8

= -1.96m/s^-2

We are to get t

t = 8/1.96

= 4.1s

P = w/t

= 640/4.1

= 156 watts

156watts is the average power that is produced by friction as the rock stops.

What is the mass of a toy truck if 18 N of force is needed to accelerate the boat to
2 m/s2 ?

Answers

Answer:

9 kg

Explanation:

Force= Mass * Acceleration

18 N= Mass * 2 m/s^2

(18 N / 2 m/s^2) = Mass

Mass= 9 kg

2. An ambulance traveling at 20 m/s emits a sound at 500 Hz. What frequency does a person standing on the corner of a street detect?

Answers

531 Hz. As ambulance approaches and 470ish as it proceeds past stationary person.

Doppler effect.

Used online calculator. Use negative 20 m/s approach and positive 20 m/s leaving or having passed the person

Lifting a stone block 146m to the top of the Great Pyramid required 146,000 J of work. How much work was done to lift the block halfway to the top?
A. 36,500 Joules
B. 73,000 Joules
C. 146,000 Joules
D. 292,000 Joules
Please help me.

Answers

B is your answer to the question

You use an electron microscope in which the matter wave associated with the electron beam has a wavelength of 0.0173 nm. What is the kinetic energy of an electron in the beam, expressed in electron volts?

Answers

Answer:

The kinetic energy of an electron in the beam is 5.04 keV.

 

Explanation:

We need to find the velocity of the electron by using the De Broglie wavelength:

[tex] \lambda = \frac{h}{mv} [/tex]

Where:

λ: is the wavelength = 0.0173 nm

v: is the velocity

m: is the electron's mass = 9.1x10⁻³¹ kg

h: is the Planck constant = 6.62x10⁻³⁴ J.s

[tex] v = \frac{h}{m\lambda} = \frac{6.62 \cdot 10^{-34} J.s}{9.1 \cdot 10^{-31} kg*0.0173 \cdot 10^{-9} m} = 4.21 \cdot 10^{7} m/s [/tex]

Now, we can find the kinetic energy:

[tex] E_{k} = \frac{1}{2}mv^{2} = \frac{1}{2}9.1 \cdot 10^{-31} kg*(4.21 \cdot 10^{7} m/s)^{2} = 8.06 \cdot 10^{-16} J*\frac{1 eV}{1.6 \cdot 10^{-19} J} = 5038 eV = 5.04 keV [/tex]

Therefore, the kinetic energy of an electron in the beam is 5.04 keV.

I hope it helps you!

WHAT IS TRANS ATLANTIC SLAVE TRADE​

Answers

Hope this kinda helps!

1. When asteroids collided some of the broken materials fall into Earth's orbit. What do
astronomers call the debris when it hits planet Earth?

Answers

Answer:

meteoroids

Explanation:

when an asteroid (or really anything else) falls to earth, it is called a meteoroid

At
room temperature, chlorine is a gas, bromine is a liquid, and
iodine is a solid. However, all
three elements share some
physical properties. They also
have very similar chemical
properties. They are grouped in the same column on the periodic table. What common property do
you observe?

Answers

Explanation:

One common property with all halogens in group 7 is that they are all non-metals.

Fluorine, chlorine, Bromine and Iodine are classified as non-metallic elements and they have a high electronegativity.

In chemical reactions, they are very reactive because they require just one electron to complete their octet configuration and be isoelectronic with noble gases.

The most prominent observation from halogens is that they all non-metallic in nature.

A magnet of mass 0.20 kg is dropped from rest and falls vertically through a 35.0 cm copper tube. Eddy currents are induced, causing the copper to warm up. The speed of the magnet as it emerges from the tube is 1.50 m/s. How much heat energy is dissipated to the environment?

Answers

Answer:

The energy lost to the environment is 0.461 J

Explanation:

Given;

mass of the magnet, m = 0.2 kg

height of fall, h = 35 cm = 0.35 m

initial speed of the magnet, u = 0

final speed of the magnet, v = 1.5 m/s

Initial energy of the magnet is given by;

E₁ = P.E₁ + K.E₁

E₁ = mgh₁ + ¹/₂mu²

E₁ = (0.2 x 9.8 x 0.35) + ¹/₂(0.2)(0)²

E₁ = 0.686 J

Final energy of the magnet as it emerges from the tube is given by;

E₂ = mgh₂ +  ¹/₂mv²

E₂ = (0.2 x 9.8 x 0) + ¹/₂(0.2)(1.5)²

E₂ = 0 + 0.225 J

The energy lost to the environment is given by;

E = E₂ - E₁

E = 0.225 J - 0.686 J

E = -0.461 J (negative sign indicates lost energy to the environment)

Therefore, the energy lost to the environment is 0.461 J

What is the approximate horizontal velocity at which the boy in the diagram
threw the ball?


a. +5m/s

b. +20m/s

c. +25m/s

d. +30m/s

Answers

Answer:

D

Explanation:

5+25=30

A flat loop of wire consisting of a single turn of cross-sectional area 7.10 cm2 is perpendicular to a magnetic field that increases uniformly in magnitude from 0.500 T to 2.10 T in 1.07 s. What is the resulting induced current if the loop has a resistance of 1.60?

Answers

Answer:

The induced current is  [tex]I = 0.00066 \ A[/tex]

Explanation:

From the question we are told that

   The area is  [tex]A = 7.10 \ cm^2 = 7.10 *10^{-4} \ m^2[/tex]

   The initial  magnetic field is  [tex]B_i = 0.500 \ T[/tex]

    The magnetic field after t =1.07 s is  [tex]B_f = 2.10 \ T[/tex]

     The resistance of the loop is [tex]R = 1.60 \ \Omega[/tex]

Generally the electromagnetic field induced is mathematically represented as

   [tex]\epsilon = NA * \frac{B_f - B_i}{t}[/tex]

Where N is the number of turns which is 1 in the case of this question since there is only one loop

 So

       [tex]\epsilon = 1 * 7.10*10^{-4}* \frac{2.10 - 0.500}{1.07 }[/tex]

=>   [tex]\epsilon = 0.00106 \ V[/tex]

Generally the value of the current is mathematically represented as

        [tex]I = \frac{\epsilon}{R}[/tex]

       [tex]I = \frac{0.00106}{1.60}[/tex]

       [tex]I = 0.00066 \ A[/tex]

 

Which of the following describes the motion or change caused by a transformation from electrical to sound energy? (2 points) a A child listens to the music from a trumpet. b A dog howls to the siren from a police car. c A person moves their arm when they hear the buzz of a fly. d Music comes out from a television speaker.

Answers

Answer:

d.music comes out from a television speaker

Explanation:

because television use electricity (electrical energy) and produce sound (sound energy) that we hear while watching tv

Answer:

The answer would be (D) Music comes out from a television speaker.

Explanation:

This is because the TV uses electrical energy from where its plugged in. And the speaker is the sound energy which is caused by the TV to go with the show you are watching.

Hope this helps!

The batter swings his bat 1.8 meters in 0.1 seconds. How fast is his bat speed in meters per second?

Answers

Answer:

18 m/s

Explanation:

1.8 meters / 0.1 seconds = 18 m/s

When an aluminum bar is connected between a hot reservoir at 720 K and a cold reservoir at 358 K, 3.00 kJ of energy is transferred by heat from the hot reservoir to the cold reservoir. (a) In this irreversible process, calculate the change in entropy of the hot reservoir._______ J/K
(b) In this irreversible process, calculate the change in entropy of the cold reservoir.
_______ J/K
(c) In this irreversible process, calculate the change in entropy of the Universe, neglecting any change in entropy of the aluminum rod.
_______ J/K
(d) Mathematically, why did the result for the Universe in part (c) have to be positive?

Answers

Answer:

a.  -4.166 J/K

b. 8.37 J/K

c. 4.21 J/K

d. entropy always increases.

Explanation:

Given :

Temperature at hot reservoir , [tex]$T_h$[/tex] = 720 K

Temperature at cold reservoir , [tex]$T_c$[/tex] = 358 K

Transfer of heat, dQ = 3.00 kJ = 3000 J

(a). In the hot reservoir, the change of entropy is given by:

[tex]$dS_h= -\frac{dQ}{t_h}$[/tex]              (the negative sign shows the loss of heat)

[tex]$dS_h= -\frac{3000}{720}$[/tex]

      =  -4.166 J/K

(b)  In the cold reservoir, the change of entropy is given by:

[tex]$dS_c= \frac{dQ}{t_c}$[/tex]              

[tex]$dS_c= \frac{3000}{358}$[/tex]

      =  8.37 J/K

(c). The entropy change in the universe is given by:

[tex]$dS=dS_h+dS_c$[/tex]

    = -4.16+8.37

   = 4.21 J/K

(d). According to the concept of entropy, the entropy of the universe is always increasing and never decreasing for an irreversible process. If the entropy of universe decreases, it violates the laws of thermodynamics. Hence, in part (c), the result have to be positive.

A falling ball has potential energy of 5 J and a kinetic energy of 10 J. What is the ball's mechanical energy?

Answers

Mechanical energy = PE + KE
5 J + 10 J = 15 J

A plane moves at a speed of 100 mi/h and takes flight on a 25 degree angle. What is the VERTICAL speed in mi/h? Round to the nearest whole number and DO NOT include units (Ex: 11).​

Answers

Answer:

The vertical speed in mi/h is 42.

Explanation:

Rectangular Components of a Vector

A 2D vector can be expressed in several forms. The rectangular form gives its two components, one for each axis (x,y). The polar form gives the components as (r,θ) being r the magnitude and θ the angle.

The relationships between the coordinates of both systems are shown in the image below.

When the magnitude and angle of the vector are given, the rectangular components are calculated as follows:

[tex]v_x=v\cos\theta[/tex]

[tex]v_y=v\sin\theta[/tex]

Where v is the magnitude of the vector and θ is the angle with respect to the x positive direction.

We are given the magnitude of the velocity (the speed) at which a plane is moving as v=100 mi/h at an angle of θ=25°, the vertical component of the velocity is:

[tex]v_y=100\sin 25^\circ[/tex]

Calculating:

[tex]v_y=42.26\approx 42[/tex]

The vertical speed in mi/h is 42.

The volume of water in a measuring cyclinder is 50 ml .When a piece of stone is immeresed in the cyclinder the volume of water increases to 87.3ml. Calculate volume of stone.​

Answers

Answer:

37.3ml

Explanation:

87.3 ml-50 ml=37.3ml

Answer:

ok

Explanation:

g

Suppose the flow rate of blood in a coronary artery has been reduced to half its normal value by plaque deposits. By what factor has the radius of the artery been reduced, assuming no turbulence occurs?
Strategy
Assuming laminar flow, Poiseuilleâs law states that
Q = (p2 - p1)pir^4/8nl.We need to compare the artery radius before and after the flow rate reduction.

Answers

Answer:

1.18

Explanation:

The flow rate of blood is proportional to the fourth power of its radius as given the Poiseuille's law.

The law is :

[tex]$Q \propto r^4$[/tex]

It is given here that the flood flow rate is been reduced to half its normal value. Therefore, [tex]$Q_1 = \frac{1}{2}Q_2$[/tex]

So, for the radius [tex]$r_1$[/tex] and [tex]$r_2$[/tex], the ratios of their flow rates are :

[tex]$\frac{Q_1}{Q_2}=\frac{r_1^4}{r_2^4}$[/tex]

It is given that the flow rate is reduced to half. So we have,

[tex]$\frac{Q_1}{2Q_1}=\frac{r_1^4}{r_2^4}$[/tex]

or [tex]$r_2=2^{1/4}{r_1}$[/tex]

[tex]$r_2=1.18 \ r_1}$[/tex]

So the radius changes by a factor of 1.18

what are the laws of newton​

Answers

Answer:

Explanation:

These are the laws of Newton

Answer:

the first law, an object will not change its motion unless a force acts upon it. the 2nd one, the force of an object is equal to its mass times it acceleration. the 3rd one is when 2 objects interact, they apply forces to each other of equal magnitude and opposite direction.

A system of 4 electrons, 18 protons, and 4 neutrons has a net charge of?

Answers

Answer:

+ 14

Explanation:

18 protons make a positive 18 charge (+18)

4 electrons make a negative 4 charge (-4)

both combined give + 18 - 4 = + 14

The four neutrons don't carry net charge, so the addition of the electrons doesn' affect the net charge found above which still gives + 14.

I’m so confused someone help

Answers

Thermal- transfer of heat thru space
Radiation- the average amount of energy of motion in the molecules of a substance
Thermometer- a thin glass tube with a bulb on one end that contains a liquid, usually mercury or colored alcohol
Brainly?
Thermal-the total energy of motion in the molecules of a substance
Radiation - the transfer of heat through space
Thermometer- a thin glass tube.....

A rod is pivoted about its center and oriented horizontally. A 5.0-N force directed upward is applied 4.0 m to the left of the pivot and another upward 5.0-N force is applied 1.5 m to the right of the pivot. What is magnitude of the total torque about the pivot?

Answers

Answer:

The total torque is 27.5 Nm

Explanation:

Given;

5.0-N force directed upward is applied 4.0 m to the left of the pivot,

5.0-N force directed upward is applied 1.5 m to the right of the pivot,

Taking the moment about the pivot, the total torque is given by;

τ = Fr

where;

F is the appllied force

r is the radius of the force arm

τ = (5 N x 4 m) + (5 N x 1.5 m)

τ = 27.5 Nm

Therefore, the total torque is 27.5 Nm

Describe and give an example of mutualism.


Describe and give an example of commensalism.


Describe and give an example of parasitism.


Describe and give an example of competition.


Describe and give an example of predation.

Answers

Answer:

Mutualism, commensalism, parasitism, competition, and predation.

Explanation:

mutualism- relationship between two or more organisms where both are benefited. Example-oxpecker with rhino/zebra. They eat bugs off of them which means that they are getting food, while the rhino/zebra are getting cleaned up with pest control.

commensalism- relationship between two organisms where one benefits and the other isn't benefited or harmed. EX- tree frogs use plants as protectioin.he frog is benefited, and the plant is neither harmed nor benefited. Remora fish have a disk on their heads that they use to attach themselves to larger animals for protection. The animals they attach to are neither harmed nor benefited.  

parasitism- in a relationship where an organism benefits at the expense of the other. (one is benefited while the other is harmed) ex- fleas and ticks that live on cats and dogs, tape worms that live in people and animals that eat the food which means that the people aren't getting the food or nutrition that they eat. lice, etc

competition- interaction within organisms/species in which both the organisms/species are harmed and is apart of natural selection. Examples may include two males fighting over a mate, animals competing over food, limited habitats that they are fighting over, territory, etc.

predation- the preying of one animal on another. It's where the predator hunts and eats another organism which is its prey. categorized within-(1) carnivory, (2) herbivory, (3) parasitism, and (4) mutualism. Each type of predation can by categorized based on whether or not it results in the death of the prey.ex- owls hunting mice, wolves hunting rabbits, lion hunting gazelle, etc.

A spaceship of mass mm circles a planet of mass M in an orbit of radius R. How much energy is required to transfer the spaceship to a circular orbit of radius 3R?

Answers

Answer:

ΔE = GmM/3R

Explanation:

The absolute potential energy of an object in a planet's field is given as:

E = -GmM/2r

where,

E = Potential Energy

G = Universal Gravitational Constant

m = mass of spaceship

M = Mass of Planet

r = distance from surface of planet

Therefore, for initial state:

E = E₁ and r = R

E₁ = - GmM/2R

and for final state:

E = E₂ and r = 3R

E₂ = - GmM/6R

So, the required energy will be:

ΔE = E₂ - E₁ = - GmM/6R + GmM/2R

ΔE = GmM(- 1/6R + 1/2R)

ΔE = GmM/3R

June does an experiment to study how salt affects the freezing point of water

Answers

Answer:

Salt melts ice and helps keep water from re-freezing by lowering the freezing point of water. This phenomenon is called freezing point depression. Salt only helps if there is a little bit of liquid water available. The salt has to dissolve into its ions in order to work.

Explanation:

You discover a binary star system in which one member is a15MSun main-sequence star and the other star is a 10MSun giant. How do we believe that a star system such as this might have come to exist?

Answers

Answer:

Explanation:

The giant star must have at least once been the more massive star and then subsequently transferred some of its mass to its companion, the other star.

The two stars would be around the same age, so the more massive one would have turned into a giant first before the other one did or even had a chance to

Two manned satellites approach one another at a relative speed of 0.400 m/s, intending to dock. The first has a mass of 5.50 ✕ 103 kg, and the second a mass of 7.50 ✕ 103 kg. If the two satellites collide elastically rather than dock, what is their final relative velocity in meters per second?

Answers

Answer:

why do you think the senate changed the way it voted? What methods did the suf

why do you think the senate changed the way it voted? What methods did the suffragis

why do you think the senate changed the way it voted? What methods did the suffragists use to influence this change?

Two manned satellites approach one another at a relative speed of 0.400 m/s, intending to dock. The first has a mass of 5.50 ✕ 103 kg, and the second a mass of 7.50 ✕ 103 kg. If the two satellites collide elastically rather than dock, what is their final relative velocity in meters per second?

hi

lolTwo manned satellites approach one another at a relative speed of 0.400 m/s, intending to dock. The first has a mass of 5.50 ✕ 103 kg, and the second a mass of 7.50 ✕ 103 kg. If the two satellites collide elastically rather than dock, what is their final relative velocity in meters per second?ts use to influence this change?

Two manned satellites approach one another at a relative speed of 0.400 m/s, intending to dock. The first has a mass of 5.50 ✕ 103 kg, and the second a mass of 7.50 ✕ 103 kg. If the two satellites collide elastically rather than dock, what is their final relative velocity in meters per second?

hi

lolfragists use to influence this change?

Explanation:

Two manned satellites approach one another at a relative speed of 0.400 m/s, intending to dock. The first has a mass of 5.50 ✕ 103 kg, and the second a mass of 7.50 ✕ 103 kg. If the two satellites collide elastically rather than dock, what is their final relative velocity in meters per second?

hi

lol

What unbalanced force is needed to give a 976 kg vehicle an acceleration of 2.50 m/s2? ASAP

Answers

Answer:

2440 N

Explanation:

The force acting on an object given it's mass and acceleration can be found by using the formula

force = mass × acceleration

From the question we have

force = 976 × 2.5

We have the final answer as

2440 N

Hope this helps you

Other Questions
What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l) Explain reasons for 13 colonies 2. What are the two types of deeds that make up the hero's journey? what plan has been made for the HRD in nepal? I do not breathe, but I run and jump. I do not eat, but I swim and stretch. I do not drink, but I sleep and stand. I do not think, but I grow and play. I do not see, but you see me every day. What am I? Both pieces of writing attacked the practices of the Catholic Church. Yet one led to a complete break, while the other did not. What in Luthers words seems uncompromising, and what in Erasmus words leaves more room for reform? What is the main function of the small intestine?(use terms : villi, surface area,blood capillaries,why must large molecules be broken down, high concentration and low concentration.) can anyone just explain how to do a distant rate time problems because I'm confused about them -4/9 divided by 2/3 what would the answer be? (First to answer gets brainiest)What three languages did theRosetta Stone, discovered in AncientEgypt, contain?A. Arabic, Baltic, and EnglishB. hieroglyphic, English and SomaliC. hieroglyphic, demotic and EnglishD. hieroglyphic, demotic and Greek