Identify the correct term for each definition.

a. the bottom chamber of both sides of the heart


b. the dome-shaped muscle at the base of the chest cavity that contracts and lowers to draw oxygen into the lungs, then relaxes and lowers to push carbon dioxide out


c. the liquid part of the blood


d. the protein that colors red blood cells and allows them to carry oxygen to the tissues


e. the passageway out of the body for urine


f. the top chamber of both sides of the heart


g. the tube that carries food to the stomach


h. the two branches of the windpipe that descend to the right and left lungs


i. muscles that operate completely outside of conscious thought


j. tiny blood vessels where pickup of wastes and delivery of oxygen and food takes place tiny filtering units in the kidneys


k. a waste product that is made up of leftover parts of used proteins and is high in nitrogen


l. urea and other waste substances that are collected in the bladder

Answers

Answer 1

a. the bottom chamber of both sides of the heart: Ventricles

b. the dome-shaped muscle at the base of the chest cavity that contracts and lowers to draw oxygen into the lungs, then relaxes and lowers to push carbon dioxide out: Diaphragm

c. the liquid part of the blood: Plasma

d. the protein that colors red blood cells and allows them to carry oxygen to the tissues: Hemoglobin

e. the passageway out of the body for urine: Urethra

f. the top chamber of both sides of the heart: Atria

g. the tube that carries food to the stomach: Esophagus

h. the two branches of the windpipe that descend to the right and left lungs: Bronchi

i. muscles that operate completely outside of conscious thought: Involuntary muscles

j. tiny blood vessels where pickup of wastes and delivery of oxygen and food takes place tiny filtering units in the kidneys: Capillaries

k. a waste product that is made up of leftover parts of used proteins and is high in nitrogen: Uric acid

l. urea and other waste substances that are collected in the bladder: Urine

a. the bottom chamber of both sides of the heart: The correct term is "ventricle." Ventricle refers to the lower chambers of the heart that pump blood to the lungs and the rest of the body.

b. the dome-shaped muscle at the base of the chest cavity that contracts and lowers to draw oxygen into the lungs, then relaxes and lowers to push carbon dioxide out: The correct term is "diaphragm." The diaphragm is a muscular sheet that separates the chest cavity from the abdominal cavity and plays a crucial role in the process of breathing.

c. the liquid part of the blood: The correct term is "plasma." Plasma is a yellowish fluid that forms the extracellular matrix of blood and contains various substances like water, electrolytes, proteins, hormones, and nutrients.

d. the protein that colors red blood cells and allows them to carry oxygen to the tissues: The correct term is "hemoglobin." Hemoglobin is a protein found in red blood cells that binds to oxygen in the lungs and transports it to the body's tissues.

e. the passageway out of the body for urine: The correct term is "urethra." The urethra is a tube through which urine is expelled from the bladder and exits the body.

f. the top chamber of both sides of the heart: The correct term is "atrium." Atrium refers to the upper chambers of the heart that receive blood from the veins before it is pumped into the ventricles.

g. the tube that carries food to the stomach: The correct term is "esophagus." The esophagus is a muscular tube that connects the throat (pharynx) to the stomach and is responsible for transporting swallowed food.

h. the two branches of the windpipe that descend to the right and left lungs: The correct term is "bronchi." Bronchi are the main air passages that branch off from the trachea (windpipe) and lead into the lungs.

i. muscles that operate completely outside of conscious thought: The correct term is "involuntary muscles." Involuntary muscles are muscles that are not under conscious control and are responsible for various automatic body functions, such as digestion, heartbeat, and breathing.

j. tiny blood vessels where pickup of wastes and delivery of oxygen and food takes place tiny filtering units in the kidneys: The correct term is "capillaries." Capillaries are the smallest blood vessels in the body that allow for the exchange of oxygen, nutrients, and waste products between the blood and surrounding tissues.

k. a waste product that is made up of leftover parts of used proteins and is high in nitrogen: The correct term is "urea." Urea is a nitrogenous waste product formed in the liver as a result of protein metabolism and is excreted in urine.

l. urea and other waste substances that are collected in the bladder: The correct term is "urine." Urine is a liquid waste product composed of water, urea, salts, and various other waste substances that are collected and stored in the bladder before being eliminated from the body.

For more such answers on Urine

https://brainly.com/question/479947

#SPJ8


Related Questions

!PLEASE ANSWER ASAP! How much of farmed aquaculture in the US consists of oysters?

Answers

two thirds

Explanation:

2 Lin sulks during the first week of rehearsals because she is – A tired from working on the set B bored with her duties as a designer C confused about the directions given to her D disappointed with the assignment she received​

Answers

Answer:

skull tropper

Explanation:

I got it from the guy from fortnite

what story is that from

what is membrane potential of a cardiac intrinsic conduction system cell?

Answers

A gradient of electrochemical potential exists across cellular membranes, allowing cardiac cells to exclusively propagate action potentials. An average cardiac cell's resting membrane potential is 90 mV.

The Goldman-Hodgkin-Katz equation, which considers permeability (P) as well as the concentration of ions both within and outside of cells ([X]), can be used to characterise this resting potential. The network of intracardiac ganglia and connecting neurons makes up the intrinsic cardiac neural system (ICNS), sometimes known as the heart's own nervous system. As a local hub that combines the inputs from the ICNS and extrinsic innervation, the cardiac ganglia function as a contributor to the tight control of cardiac electrophysiology.

To know more about electrochemical, click here:

https://brainly.com/question/31606417

#SPJ4

How does erosion and deposition shape the landscape?

Answers

Answer:

The material moved by erosion is sediment. Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. Water's movements (both on land and underground) cause weathering and erosion, which change the land's surface features and create underground formations.

Explanation:

have a good day/night

may i please have a branlliest

According to catastrophists what was the rate of geological change?

Answers

Catastrophism is the theory that the Earth has largely been shaped by sudden, short-lived, violent events, possibly worldwide in scope.[1] This is in contrast to uniformitarianism (sometimes described as gradualism), in which slow incremental changes, such as erosion, created all the Earth's geological features. The proponents of uniformitarianism held that the present was the key to the past, and that all geological processes (such as erosion) throughout the past were like those that can be observed now. Since the early disputes, a more inclusive and integrated view of geologic events has developed, in which the scientific consensus accepts that there were some catastrophic events in the geologic past, but these were explicable as extreme examples of natural processes which can occur.

Mom has O blood and dad has O blood. What blood type(s) will their children have?

Answers

Answer:

A mother who is blood type O can only pass an O allele to her son or daughter. A father who is blood type AB could pass either an A or a B allele to his son or daughter.

Explanation:

Hope this helped :)

A false-positive csf serologic test for neurosyphilis in a treated patient can occur if:

Answers

A false-positive CSF serologic test for neurosyphilis in a treated patient can occur due to various factors. These factors include contamination, serologic cross-reactivity, the persistence of nontreponemal antibodies, a rebound phenomenon, and biological false positives (BFPs).

A false-positive CSF serologic test for neurosyphilis in a treated patient can occur due to various factors. These factors include contamination, serologic cross-reactivity, the persistence of nontreponemal antibodies, a rebound phenomenon, and biological false positives (BFPs). The cerebrospinal fluid (CSF) serologic test is a significant diagnostic tool used in the diagnosis of neurosyphilis. However, it has been observed that this test can produce false-positive results, even in treated patients. This can occur due to various reasons, including contamination, serologic cross-reactivity, the persistence of nontreponemal antibodies, a rebound phenomenon, and biological false positives (BFPs).Contamination: This is one of the most common reasons for false-positive results in CSF serologic tests. This can occur due to errors during the collection, transport, and processing of the specimen. Even minor contamination can lead to false-positive results in these tests. Therefore, it is essential to ensure that the sample is appropriately collected, handled, and processed.Serologic cross-reactivity: Another reason for false-positive results in CSF serologic tests is serologic cross-reactivity. This occurs when the antibody produced in response to an infection or vaccination reacts with the antigen of another microorganism. In the case of neurosyphilis, cross-reactivity can occur with other spirochetes such as Borrelia burgdorferi, which causes Lyme disease.The persistence of nontreponemal antibodies: The nontreponemal antibodies produced in response to syphilis can persist even after the treatment. These antibodies can lead to false-positive results in the CSF serologic test, even though the patient has been adequately treated. Therefore, the presence of nontreponemal antibodies should be taken into account while interpreting the test results.A rebound phenomenon: The rebound phenomenon is another reason for false-positive results in CSF serologic tests. This phenomenon occurs when there is a rapid decrease in the antibody titer after the treatment, followed by a rapid increase. This can lead to false-positive results, even if the patient has been adequately treated.Biological false positives (BFPs): BFPs are a rare phenomenon that can lead to false-positive results in CSF serologic tests. This can occur due to a genetic mutation or immunological condition that leads to the production of an antibody that reacts with the antigen in the serologic test.

To know more about cerebrospinal fluid visit: https://brainly.com/question/13050022

#SPJ11

I need help not sure

Answers

Answer:

The answer is 2

Explanation:

D,H,J are closely related because they are sharing traits, and it is the most relevant answer

How many chambers does a dog's heart
have?

Answers

Answer:

There are four chambers in the dog's heart: two top chambers (the atria) and two bottom chambers (the ventricles).

Explanation:

Answer:

It has 4 chambers

Explanation:

sorry if im wrong

The Gulf of Mexico dead zone is an area of hypoxic waters at the mouth of the Mississippi River. Its area varies in size, but can cover up to 6,000-7,000 square miles. The zone occurs between the inner and mid-continental shelf in the northern Gulf of Mexico, beginning at the Mississippi River delta and extending westward to the upper Texas coast. Thousands of farms are located along the Mississippi River and its tributaries and as water washes into the river after a heavy rain, it brings with it nutrients from fertilizers added to farmland. These materials flow downriver and eventually enter the Gulf of Mexico, where they create conditions for a dead zone: an area of low to no oxygen that results in the death of fish and other marine life. The Gulf of Mexico is a major source area for the seafood industry. The Gulf supplies 72% of U.S. harvested shrimp, 66% of harvested oysters, and 16% of commercial fish. Consequently, if the hypoxic zone continues or worsens, fishermen and coastal state economies will be greatly impacted. What can be done to minimize the Gulf dead zone? Choose ALL that could apply. A) Control of animal wastes so that they are not allowed to enter into waterways. B) Adjust the timing of fertilizer applications to limit runoff of excess nutrients from farmland. C) Monitor septic systems and sewage treatment facilities to reduce discharge of nutrients to surface water and groundwater. D) Restrict land use in the areas surrounding the Mississippi delta to exclude industrial sites. E) Counter the effects of fertilizers on algal growth in the Gulf with the use of chemical herbicides.

Answers

This Is Confusing Could U put more Details

The things that should be done to minimize the Gulf dead zone include:

A. Control of animal wastes so that they are not allowed to enter into waterways. B. Adjust the timing of fertilizer applications to limit runoff of excess nutrients from farmland.E. Counter the effects of fertilizers on algal growth in the Gulf with the use of chemical herbicides.

It should be noted that it's important to manage nutrients efficiently in farmlands through the restoration of wetlands in order to capture nutrients and then reduce runoff.

In order to minimize the Gulf dead zone, there should be control of animal wastes so that they are not allowed to enter into waterways. Also, there should be an adjustment of the timing of fertilizer applications to limit runoff of excess nutrients from farmland.

Read related link on:

https://brainly.com/question/17876202

What is a negative feedback loop? Provide an example NOT related to Biology. (I will give brainliest)

Answers

Answer:

Examples of processes that utilise negative feedback loops include homeostatic systems, such as Thermoregulation if body temperature changes, mechanisms are induced to restore normal levels) Blood sugar regulation (insulin lowers blood glucose when levels are high glucagon raises blood glucose when levels are low)

Explanation:

Answer: A negative feedback loop is basically a procedure that uses criticism to make positive changes to a process

Ferns tend to live in which of the following habitats?"
moist and sunny
moist and shady
O dry and sunny
Odry and shady

Answers

Answer:

Moist and shaddy

Explanation:

moist and shady
hope it helps

Can throat cancer be inherited?

Answers

Most throat cancers are generally related to smoking and not hereditary, unless the family members are predisposed to smoking.

No not really. Only genes

The diagram shows part of an aquatic food web
for a stable lake ecosystem in Connecticut.
Turtles
Large fish
Small fish
Aquatic insects
Tadpoles
Water fleas
Rotifers
Algae
What is the source of energy for the algae?
A waves
B. sunlight
C. bacteria
D. rotifers, water fleas and tadpoles

Answers

Answer:

Sunlight

Explanation:

I just got it wrong because of the wacko below or above me gave me the wrong answer

Algae possess chlorophyll in their cells. They use carbon dioxide in a manner that is analogous to how we use food. Thus, option B is correct.

What is a characteristic feature of algae?

By converting light energy to chemical energy through the process of photosynthesis, carbon dioxide and water are transformed into organic molecules.

Nearly all algae engage in the process, and in fact, much of what is currently known about photosynthesis was first uncovered through research on the green alga Chlorella.

Like other plants, algae benefit from sunlight, therefore denying them of it will limit or even completely stop their growth. For several days, completely shading the tank or aquarium from light is essential.

Therefore,  algae require sunshine because algae can photosynthesize, or use sunlight to change carbon dioxide into biological material.

Learn more about algae here:

https://brainly.com/question/13921782

#SPJ2

T/F. short wavelengths from high-pitched sounds cause displacement of the basilar membrane near the oval window.

Answers

The statement "short wavelengths from high-pitched sounds cause displacement of the basilar membrane near the oval window" is true.

To provide a more accurate explanation:

The cochlea, a spiral-shaped structure in the inner ear, plays a crucial role in the process of hearing. Within the cochlea, the basilar membrane is a key component that vibrates in response to sound waves.

When sound waves enter the ear, they travel through the auditory system and reach the cochlea. The oval window, which is located at the base of the cochlea, receives these sound vibrations and sets the fluid inside the cochlea into motion. This motion causes the basilar membrane to vibrate.

The basilar membrane is structured in a way that it varies in width and stiffness along its length. This variation allows different regions of the basilar membrane to respond selectively to different frequencies of sound. The base of the cochlea, near the oval window, is narrower and stiffer, while the apex of the cochlea is wider and more flexible.

High-pitched sounds, which have short wavelengths and higher frequencies, specifically cause displacement of the basilar membrane near the base of the cochlea, close to the oval window. This region of the basilar membrane is more responsive to high-frequency sounds. As a result, the basilar membrane near the oval window detects and responds to these short-wavelength, high-pitched sounds.

In summary, short wavelengths from high-pitched sounds cause displacement of the basilar membrane near the oval window, as this region is specifically responsive to high-frequency sounds.

To know more about wavelengths follow the link:

https://brainly.com/question/31143857

#SPJ4

Match the following world's countries with the plate boundary they are located Ethiopia, Kenya, Tanzania region Continent-Continent Div [选择] Ocean-Ocean Convegent Japan ✓ Ocean-Continent Convergent Continent-Continent Transform Ocean-Ocean Divergent Continent-Continent Divergent Iceland Continent-Continent Convergent Ecuador/Western South America Continent-Continent Co USA/Southern California Ocean-Continent Conve v Nepal/Tibet/China region Continent-Continent Co

Answers

Here is the matching of the countries with the corresponding plate boundary:

Ethiopia, Kenya, Tanzania region: Continent-Continent Divergent

Japan: Ocean-Ocean Convergent

Iceland: Continent-Continent Divergent

Ecuador/Western South America: Continent-Continent Convergent

USA/Southern California: Ocean-Continent Convergent

Nepal/Tibet/China region: Continent-Continent Convergent

Let's explain the reasoning behind each match:

Ethiopia, Kenya, Tanzania region:

This region is located along the East African Rift System, which is a classic example of a continent-continent divergent boundary.

It is where the African Plate and the Somali Plate are moving away from each other, causing the formation of a rift valley.

Japan: Japan is situated along the Pacific Ring of Fire, which is characterized by subduction zones where oceanic plates converge with continental plates.

Therefore, Japan is located at an ocean-ocean convergent boundary.

Iceland: Iceland is located on the Mid-Atlantic Ridge, which is a divergent boundary between the Eurasian Plate and the North American Plate.

As the plates move apart, magma rises to the surface, creating new crust and causing volcanic activity.

Thus, Iceland is at a continent-continent divergent boundary.

Ecuador/Western South America:

This region lies along the boundary between the Nazca Plate and the South American Plate.

The Nazca Plate is subducting beneath the South American Plate, resulting in the formation of the Andes Mountains.

Hence, Ecuador and Western South America are located at a continent-continent convergent boundary.

USA/Southern California: Southern California is located along the boundary between the Pacific Plate and the North American Plate.

The Pacific Plate is moving northwestward relative to the North American Plate, resulting in a transform boundary.

Therefore, the plate boundary in this region is a continent-continent transform boundary.

Nepal/Tibet/China region:

This region is part of the Himalayan mountain range, formed by the collision of the Indian Plate with the Eurasian Plate.

It is a classic example of a continent-continent convergent boundary.

It's important to note that plate boundaries can be complex and may have variations within a particular region.

The matches provided here represent simplified classifications for each country's general plate boundary.

For similar question on Eurasian Plate.

https://brainly.com/question/16939139

#SPJ8

_____ in carbon dioxide in your red blood cells, which causes _____ in pH, causes your breathing to speed up. See Concept 42.6 (Page) View Available Hint(s) _____ in carbon dioxide in your red blood cells, which causes _____ in pH, causes your breathing to speed up. See Concept 42.6 (Page) A decrease ... a drop An increase ... a rise An increase ... a drop A decrease ... a rise Actually, it is the rise and fall of oxygen, not carbon dioxide, that controls breathing.

Answers

Answer:

1 An increase

2 A drop

Explanation:

why is correct measurement important​

Answers

Explanation:

help in giving accurate information

Which kingdom contains the first eukaryotes?

Answers

Fungi hope this helps

Which of the following describes a mechanism by which microtubules are known to be statſilized? a) Shortening of the GTP cap. b) Increasing the proportion of alpha-tubulin subunits relative to beta-tubulin subunits. c) Binding of microtubule binding proteins, such as Tau. d) Conformational changes undertaken by beta-tubulin as it bhydrolyzes GTP.

Answers

Microtubule stabilisation is known to occur through the interaction of microtubule-binding proteins like Tau. Hence (c) is the correct opton.

Cell division, ciliogenesis, and intracellular trafficking are three crucial eukaryotic processes that are mediated by microtubules, which are cytoskeletal elements. They come together from -tubulin heterodimers and separate through a process known as dynamic instability that is triggered by GTP hydrolysis. They have a role in a number of cell motions, including as some types of cell motility, the intracellular movement of organelles, and the division of the chromosomes during mitosis, in addition to determining the shape of the cell. These findings imply that GTP functions in microtubule assembly by first giving tubulin a conformation that is conducive to polymerization, and then by hydrolyzing GTP bound to tubulin to irreversibly change the balance in favour of polymerization.

To know more about Microtubule, click here:

https://brainly.com/question/31670866

#SPJ4

Describe why food needs to be digested from large to small molecules.

Answers

Answer:

Food must be broken down into nutrients for the body to use for energy, development, and cell repair. Before the blood absorbs and transports nutrients to cells in the body, food and drink must be broken down into smaller nutrient molecules.

PLZ HELP 25 POINTS!!!

Give an example of how Eubacteria can be harmful. Explain.

Answers

Answer: However, bacteria can also cause disease. Examples of bacterial diseases include tetanus, syphilis, and food poisoning. Bacteria may spread directly from one person to another. For example, they can spread through touching, coughing, or sneezing. Some Eubacteria can induce serious diseases such as tuberculosis, meningitis, anthrax, leprosy, cholera and tetanus. Antibiotics disrupt normal functioning of bacterial ribosomes or synthesis of the cell wall and prevent further multiplication of bacteria in the body.

Explanation:

do you agreed that cell is a building unit of organism yes explain why?class 9​

Answers

Answer:

It can be, but not really

Explanation:

This is because cells can be the building block of an organism, e.g. humans, but they can also be their own separate organism, such as a bacteria.

Which of the following would be considered adaptations for a predator? Select ALL that apply.
A. Thorns on a plant
B. Sharp Claws
C. Aposematism (Warning Coloration)
D. Strong sense of smell
E. Ability to run quickly

Answers

The adaptations of a predator from the given options would be sharp claws, aposematism (warning coloration), a strong sense of smell, and the ability to run quickly. Here options B, C, D, and E are the correct answer.

B. Sharp Claws: Sharp claws enable a predator to grasp and immobilize prey, providing an advantage in capturing and subduing prey efficiently.

C. Aposematism (Warning Coloration): Aposematism refers to the display of vibrant, contrasting colors or patterns that warn potential prey of the predator's toxicity or dangerous nature. This adaptation deters potential prey from approaching or attacking the predator, allowing it to avoid unnecessary conflict and conserve energy.

D. Strong sense of smell: A predator with a keen sense of smell can detect the scent trails left by prey, increasing its ability to locate and track potential targets. This adaptation provides an advantage in locating prey and improving hunting success.

E. Ability to run quickly: The ability to run swiftly is advantageous for predators as it enables them to chase down prey, close the distance, and launch an attack. This adaptation improves their chances of capturing fleeing prey.

To learn more about predators

https://brainly.com/question/28871161

#SPJ4

nad is directly involved a) only glycolysis b) only ppp c) both pathways d) neither pathway

Answers

NAD (Nicotinamide adenine dinucleotide) is directly involved in (C) both glycolysis and the pentose phosphate pathway (PPP).

In glycolysis, NAD acts as a coenzyme and plays a crucial role in the redox reactions of the pathway. During the conversion of glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate, [tex]NAD^{+}[/tex] is reduced to NADH. This reduction reaction allows NADH to carry high-energy electrons to the electron transport chain for ATP production.

In the pentose phosphate pathway, [tex]NADP^{+}[/tex] (a phosphorylated form of NAD) serves as a coenzyme. [tex]NADP^{+}[/tex]is utilized in the oxidative phase of the pathway to facilitate the oxidation of glucose-6-phosphate to generate NADPH. NADPH is an important reducing agent used in biosynthetic processes, antioxidant defense, and reductive reactions within the cell.

Therefore, NAD is directly involved in both glycolysis (in the form of NADH) and the pentose phosphate pathway (in the form of [tex]NADP^{+}[/tex] and NADPH). The correct answer is option C) both pathways.

Learn more about NAD (Nicotinamide adenine dinucleotide):

https://brainly.com/question/30323008

#SPJ11

Chloroplasts do photosynthesis in which plant structure?
A. stem

B. leaves

C. roots

Answers

The answer will be b

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

what factor may contribute to the higher food insecurity on the african continent,in the middle east,and in asia?

Answers

Answer:

The most common causes of food insecurity in Africa,middle east and asia: population growth, drought, extreme weather events and other agricultural problems.

Explanation:

a 30 rock cut cave monuments famous for its murals



Ineeditnow​

Answers

Answer:

Ajanta Caves

Explanation:

Which of the following is the correct binomial format? O Genus species O Phylum class O Species O Order family

Answers

The correct option is A, The correct binomial format is "Genus species."

Genus species is a scientific naming convention used in taxonomy to classify and categorize living organisms. It represents the two main levels of classification below the higher taxonomic ranks of family, order, class, phylum, and kingdom. The genus refers to a group of closely related species that share common characteristics and ancestry. It is always capitalized and italicized when written in scientific literature.

The species name, on the other hand, is a specific epithet that further distinguishes individual organisms within a genus. It is written in lowercase and also italicized. The combination of the genus and species names provides a unique binomial nomenclature for each organism, enabling scientists to communicate and identify species consistently. For example, Homo sapiens represents the genus Homo (including humans and their close relatives) and the species sapiens, which is specific to modern humans.

To learn more about Genus species visit here

brainly.com/question/30346312

#SPJ4

Other Questions
McKenzie spends $13.00 of the $20.00 in her wallet. Which decimal represents the fraction of the $20.00 McKenzie spent? Which of the options BEST explains how the following lines contribute to Beowulf's characterization as a HERO:a Beowulf is a Daneb Beowulf has defeated evilc Beowulf fights for a princed Beowulf only fights for himself Pls helppFrAlgebra Sole proprietorships and partnerships are not subject to income tax in Canada. True Or False? PLEASE HELP! POR FAVOR AYDAME! SPANISH! ESPAOL!El doctor va a llamar a la farmcia para _____. 1. Elmo has big nose, and his wife Zoe has a little nose. All of their babies have medium size noses. Is nose size determined by alleles that show regular dominance, incomplete dominance, or codominance? Pick a symbol for the big nose allele ______ Pick a symbol for the little nose allele______ essay on trade unions and labor restrictions The number of cellular phones in use in the United States is increasing exponentially The number, N, in millions, in use is given by the exponential function N(t) -0.05(1.32), where "q" is the number of years after 1990. (Source: Cellular Telecommunications and Internet Association) Find N(30) and explain its meaning in the context of the scenario, b. Find t when N(O) = 420 and explain its meaning in the context of the scenario, c. Explain the meaning of the value 1.32 (from the equation) in the context of the scenario. 4. Use your calculator's graphing feature to solve 3' = 4x+5. Explain how you used your calculator and reproduce any tables or graphs produced by your calculator. Include detailed graph for points too please. Can someone really help me! .Helium gas is compressed from 27 C and 3.50 m^3/kg to 0.775 m3/kg in a reversible and adiabatic manner. The temperature of helium alter compression is ___. a) 547 C b) 709 C c) 74 C d) 1082 C e) 122 C The mean orbital radius of the earth around the sun 1.5 108 km. Calculate the mass of the sun if G = 6.67 10-11 Nm2/kg -2? Are you guys able to solve it? Rommer Company purchases Daley Inc. for cash on January 1, 2018. The book value of Daley Company's net assets, as reflected on its December 31, 2017 statement of financial position is . An analysis by Rommer on December 31, 2017 indicates that the fair value of Daley's tangible assets exceeded the book value by , and the fair value of identifiable intangible assets exceeded book value by . How much goodwill should be recognized by Rommer Company when recording the purchase of Daley Inc.? A. B. C. D. QUESTION 30 5. (15 pts.) Hanton is a start-up company that produces mobile phone accessories. The company has estimated the following data to produce a new product they are planning to sell: Fixed cost of production = $78,500 Material cost per unit = $4.15 Labor cost per unit = $3.27 Revenue per unit = $24.99 4 Note that, fixed cost is incurred regardless of the amount of units produced. Variable cost per unit is made up of per-unit labor and material costs. It is assumed that Hanton sells all the units they produce. Therefore, the profit is calculated by subtracting the total costs from the total revenue. Note that there is no data file for this problem - create an Excel spreadsheet model to answer the following questions. . (4 pts.) Setup a spreadsheet model using the principles covered in the lectures and tutorial videos. (2 pts.) Using the spreadsheet model setup above, what would be the total profit if the company decides to produce 3,500 units? (3 pts.) Create a one-way data table varying the production amount from 0 to 20,000 in increments of 1,000. Use the production amount as the column input and the total profit as the output. (2 pts.) Using the one-way data table, identify the interval of production amount where breakeven happens. (Breakeven is when the total profit goes from negative to positive) - (4 pts.) Find the exact breakeven point using Goal Seek. (Round your answer to the nearest integer) o Set cell: location of profit, To value: 0, By changing cell: location of the production amount Attach File Which of the following is NOT somethingthe atmosphere does?A. traps in warmthB. keeps Earth in a spherical shapeC. provides oxygen to breatheD. protects Earth from meteoroids Arabian Gulf Corporation reports the following stockholders' equity section on December 31, 2020. Common stock; $10 par value; 500,000 shares authorized; 200,000 shares issued and outstanding - Paid in capital in excess of par value, common stock $ 2,000,000 ..400,000 900,000 - Retained earnings.. Total $3,300,000 The Corporation completed the following transactions in 2021. 1- Jan. 10, Directors declared a $1 per share cash dividend payable on March 15 to the Jan 31 stockholders of record 2- Mar. 01, Purchased 10,000 shares of its own common for $15 per share. 3- Mar. 15, Paid the cash dividend declared on Jan. 10. 4- May 01, Sold 6,000 of its treasury shares at $15 cash per share 5- Sep. 30, Directors declared a 30% stock dividend when the share market price is $16 6- Nov. 01, Distributed stock dividends declared on Sep. 30. 7- Nov. 15, The company implemented 5-for-1 stock split for the common stock. Required: Prepare journal entries to record each of these transactions for 2021. (a) Michael Onipa, a Chartered Accountant, is under pressure from his employer to under declare sales for the year ended 2021 to save the company from paying the due tax for the year. He has evaluated the threat to his professional obligations to comply with the fundamental principles of good ethical behavior, as significant. He has therefore considered safeguards to eliminate or reduce the threat to an acceptable level. Required: Discuss TWO (2) safeguards Michael Onipa could consider to either eliminate or reduce the threats to an acceptable level. (b) The directors of Pharma Ghana Ltd are very confident about the quality of the products that the company sells. Historically, the level of complaints received about product quality has been low. However, when calculating their warranty provision, they have over-estimated the number of items that will be returned as faulty. The directors believe that this is acceptable because it is important for financial statements to exhibit prudence. Required: Discuss the ethical issues raised by the treatment of the warranty provision. Which statement is true of reproduction thatinvolves two parents?O A. Offspring are exact copies of the parent.O B. Each parent provides the offspring withgenetic material.O C. Single cells reproduce in this way.O D. Bacteria reproduce in this way. 4.How does the amplitude of a wave relate to the brightness of the light? Canoe Company's manufacturing accounting system uses direct labor costs to apply overhead to goods in process and finished goods inventories. Canoe Company's manufacturing costs for the year were: direct labor, $30,000; direct materials, $50,000; and factory overhead applied, $6,000. The plant-wide overhead application rate was: