if little jimmy has $384729204399763848349392489996544454475748485119282937346584393213474738473.00 and butthead has $23345564757548585738494872934820417437474744841656954566503756532865286535632896526156275657516963654354639565435645561539655643584361956569415655635763793465756573465953465430161589584395538953765397528935972525795270.00 how much more money does Butthead have than Little Jimmy? will mark brainless

Answers

Answer 1

Answer:

Butthead has $2.3345564757548586e+217 more money than Little Jimmy. Step-by-step explanation:

Since we need to find the difference, subtract the larger number by the smaller number. In this case, Butthead’s money minus Little Jimmy’s money. The two SUPER BIG numbers can be converted to:

2.3345564757548586e + 217 − 3.8472920439976386e + 74

This equals: 2.3345564757548586e+217

So, Butthead has $2.3345564757548586e+217 more money than Little Jimmy.

There you go!

Answer 2

Answer:

since the person above me needs brainliest im answering so she/he will get it

Step-by-step explanation:


Related Questions

A migrating bird flies 42 miles in 3 hours. How many miles does it fly in 5 hours?

Answers

42/3 = 14 miles per hour
14 * 5 = 70
Solution: 70 miles

Answer:

70 miles.

Step-by-step explanation:

In this question we are given the speed of the migrating bird. If we remember the definition of speed we will remember that speed is distance the object/body traveled, divided by the time it took the object/body to travel this distance.

Solution:

Firstly we need to find out what distance will the bird travel in 1 hour.  We can easily do that science we know the distance it travels in 3 hours. So we just use the property of a fraction that states that if we multiply or divide the denominator and the numerator by the same number we will get a fraction of the same value but written a bit differently. So we divide the numerator and the denominator by 3 and get

[tex]\frac{42 miles}{3 hours}[/tex] = [tex]\frac{14 miles}{1hour}[/tex]

Now we know what distance the bird travels in one hour so we can easily figure how much the bird will travel in 5 hours by multiplying the numerator and the denominator by 5. So we do...

[tex]\frac{14 miles}{1 hour}[/tex] = [tex]\frac{70 miles}{5 hours}[/tex]

And we get that the bird will travel 70 miles in 5 hours.

Which expression can be used to determine 50% of 42? 42 minus 2 42 divided by 2 42 divided by 10 42 minus 10

Answers

Answer:

We know that 50% of 42 will be = 21

i.e. 50% of 42 = 50/100 = 21

The correct answer should be: 42 divided by 2

Step-by-step explanation:

We know that 50% of 42 will be = 21

i.e. 50% of 42 = 50/100 = 21

Also, when we divide 42 by 2, we get the answer 21.

i.e. 42/2 = 21

Therefore, the correct answer should be: 42 divided by 2

Answer:The Answer is b

Step-by-step explanation: i did this the other guy can get brainlyest.

Have a nice day! :D

For the high school's production of "Grease," 315 tickets were sold. The cost of a student ticket, s, was $5; the cost of all other tickets, t, was $8. The total income from ticket sales equaled $2211. The system of equations below can be used to determine the number of each type of ticket sold. s+t=315 55 + 8 = 2211 How many student tickets were sold?​

Answers

Answer:

103 students tickets were sold

Step-by-step explanation:

103 times $5 = $515

212 times $8 = $1696

$515 + $1696 = $2211

Kevin spent 10 hours doing homework last week. This week he spent 15 hours doing homework. He says that he spent 150% more time doing homework this week. Is he correct? Show your work to justify your decision.

Answers

No he is wrong because 75% more time would be spent doing homework

all of the following represents the same expression except ___.

a. -8ab
b. -8(a)(b)
c. 8 - ab
d. -8 • a • b​

Answers

Answer:

What is the following expresion?

Step-by-step explanation:

Answer:

C. 8 - ab

Step-by-step explanation:

all the other represents -8 multiply by a by b.

8x=24
Solve the equation for x

Answers

Answer:

x=3

Step-by-step explanation:

Divide both sides by 8.

Answer:

3

Step-by-step explanation:

8x3=24..............

The measures of two supplementary angles are ( 2x-11 )° and ( 3x+1 )°. Find the value of x.

Answers

(2x - 11) + (3x+1) = 180
5x - 10 = 180
5x = 190
x = 38

What is the mapping notation for translating point
(x,y) down 3 units?
A.
(x,y+3)
B.
(x-3,y)
C.
(X+3,y)
D.
(x,y-3)

Answers

D.(x,y-3)
Because x basically represents the horizontal and y represents vertical
D because when it goes down the y axis and is negative

Which of these expresses the distributive property?

a) (a + b) + c = a +( b + c)
c) a(bc) = (ab)c
d) a( b + c) = ab + ac

Answers

9514 1404 393

Answer:

  d)  a(b + c) = ab + ac

Step-by-step explanation:

The distributive property explains how multiplication distributes over addition. It can be expressed by the equation ...

  a(b + c) = ab + ac

Write in standard form 8x2−5+7x4−9x−x5


Please explain i don't understand

Answers

this is the standard form of your question.

The standard form of the expression is x⁵+ 7x⁴ + 8x² - 9x - 5.

What is Polynomial?

Polynomial is an expression consisting of indeterminates and coefficients, that involves only the operations of addition, subtraction, multiplication, and positive-integer powers of variables

To write the given expression in standard form, we need to arrange the terms in descending order of their exponents (from highest to lowest).

So we start by rearranging the given expression as:

x⁵+ 7x⁴ + 8x² - 9x - 5

Now the terms are ordered from highest to lowest exponent.

Now we need to rewrite the expression by collecting like terms and arranging the coefficients in descending order of exponent.

The standard form of the expression is:

x⁵+ 7x⁴ + 8x² - 9x - 5

Hence, the standard form of the expression is x⁵+ 7x⁴ + 8x² - 9x - 5.

To learn more on Polynomials click:

https://brainly.com/question/11536910

#SPJ3

PLS HELP ASAP PLSS I ONLY HAVE 10 MINUTES

Answers

Answer:

$20 :)

Step-by-step explanation:

There's a pattern in the table of adding 20 each time, so subtract 20 from 40 to get the answer!

Your answer is B: $20.

(You can get to this answer by dividing the number of tickets by the cost.)

Hope this helps!

what is 1/4 divided by 5.

Answers

Answer: 1/20 or 20

Step-by-step explanation:

Find the degree of the polynomial below. 4x^3-9x^2+8x+5

Answers

Answer:

3

Step-by-step explanation:

4x³ - 9x² + 8x + 5

Here, the degree of the polynomial is 3

-TheUnknownScientist

Answer:

the right answer is 3

Step-by-step explanation:

right answer is 3

Which phrase matches the algebraic expression below?
2(x - 7) +10

Answers

Answer:

2 times the difference of x minus 7 plus 10

Step-by-step explanation:

When dealing with equations, you ALWAYS do the parentheses first. The first relationship x and 7 are going to have is being subtracted from eachother. Once you do that, you can do the rest of the equation. Hope this helps!

Write the equation of a line that is perpendicular to the equation y=2/3x-6, but that passes through the point (2, 3).

Answers

Answer:

y=−3/2x+6

Step-by-step explanation:

perpendicular, so theres a lot of switching things

Li bought five lip balms. Each lip balm costs the same amount. She spent a total of $7.25.
Using the variable c to represent the cost of each lip balm, write an equation that represents the situation.

C=??

how did u get that answer=??

Answers

Answer:

Its 1.45, you didn't have to ask a question just look it up

Step-by-step explanation:

7.25-5c

the sizes of the angles in degrees of the quadrilateral are
x+10
2x
x+30
x+80

a) use this information to write down and equation in terms of x
b) use your answer to part a to work out the size of the smallest angle of the quadrilateral

Answers

Answer:

5x+120

Step-by-step explanation:

first you add the 2x x and x and x that would get you 5x and then add the 20 and 10 and 80 that would get you 120

How many solutions does this system of equations
have?

A: Infinitely many
B: Exactly two
C: None
D: Exactly one

Answers

Answer

d i think

Step-by-step explanation:

almost positive there are two equations.

Find the slope of the line through each pair of points.
6. *
(4, 10), (0, 3)

Answers

Answer:

Slope: 1.75

Step-by-step explanation:

Slope = (3-10) / (0-4)

         = -7 / -4

         = 1.75

Lucille has an aquarium with 9 gallons of water which weighs 85 pounds. The stand holding the aquarium can hold no more than 112 pounds. She wants to add 2.5-pound rocks, r, her tank. Complete the inequality to show how many rocks she can add.

Answers

Answer:

7.1

Step-by-step explanation:

Mazie bought a bike during a 20% off sale and saved $16. What was the original price?

Answers

Answer:

$80. Which means she spent $64 with the sale, but the original price is $80.

Step-by-step explanation:

16 is 20% of 80

Answer

The answer is $120.00

Options

What was the price of the bicycle when Mazie bought it?

$140.00

$149.80

$130.00

$120.00

Explanation

Multiply the price of the bike by the discount percentage

150 * 0.20 = 30

Subtract the number you just found from the original price

150 - 30 = 120

There is your answer

You could take a shortcut by doing the following

1 - 0.20 = 0.80

Then multiply the original value by the new percentage

150 * 0.80 = 120

Personally I like the first method because it makes more sense.

If 4m + 1 = 7 then 4m = 6
1) Symmetric Property 2) Subtraction Property of Equality
3) Substitution Property 4) Transitive Property

Answers

Answer:

2) Subtraction Property of Equality Properties

General Formulas and Concepts:

Pre-Algebra

Addition Property of Equality - Adding on both sidesSubtraction Property of Equality - Subtracting on both sidesMultiplication Property of Equality - Multiplying on both sidesDivision Property of Equality - Dividing on both sidesTransitive Property - If a = b and b = c, then a = cSymmetric Property - If a = b then b = a

Step-by-step explanation:

Step 1: Define

4m + 1 = 7 → 4m = 6

Step 2: Identify

We see that we subtracted on on both sides of the equation. Therefore, we would have to use the Subtraction Property of Equality. Therefore, 2 is our answer.

what is the slope of (4,3) and (1,-1) the line is positive

Answers

The slope would be 1.33

Sam went on a hike. He hiked in a straight line 6.4 km east, then walked in a straight
line going south for 4.6 km. Determine how far Sam was from his starting point at
this point in his hike, rounded to the nearest tenth of a km. Show all of your steps.

Please I need help asap

Answers

Answer:

he walked 11.0km the nearest tenth would be 10.0km

Step-by-step explanation:

hope this helps

what is the distance between the points (-2, 1) and (3, 1)

Answers

Answer:

Step-by-step explanation:

2.23606797

A car factory is able to produce 120 cars per day. A new technology innovation improves the production by 10%. How many cars can the factory now produce in 5 days?

Answers

660
Explanation
120x1.1=132
132x5= 660

Keith spent half of his allowance going to the movies. He washed the family
car and earned 7 dollars. What is his weekly allowance if he ended with
14 dollars ?

Answers

Answer:

28

Step-by-step explanation:

because he spent half of 28 which is 14 and 7x4=28 BOOM

Please explain how you answered it along with your answer - thanks

Answers

Answer:

B

Step-by-step explanation:

Because you have to separate the equation. So you get [tex]\frac{2x-4}{3}[/tex]>[tex]\frac{1}{5}[/tex] And [tex]\frac{2x-4}{3}[/tex]<6

Then you have to solve for x so you get x>[tex]\frac{23}{10}[/tex] and x>11

Then you find the intersection so the answer is B

The Sweetest Jelly Company sells jellies in i pound jars. How many jars can
be filled from 24 pounds of jelly?

Answers

He can fill 6 jars with 24 pounds of jelly

30 greater than 1/2ₓ

Answers

Answer: True.

Step-by-step explanation:

The answer is : true
Good luck
God bless you
Other Questions
At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab? what is a film interpretation The students are trying to raise 3.000 but they only have 1200 how much would they need to get to 3000 According to the graph below, at which point is the plant preforming the most photosynthesis? A. Point D. B. Point B. C. Point C. D. Point A.