| Wild Type | 8 |
| Brown | 241 |
| Bright-Red | 239 |
| Orange | 12 |
Which factor listed below is abiotic? Bacteria, water, fungi, protists
Answer:water
Explanation:
Answer:
Water
Explanation:
Water does not contain cells, therefore it is non-living.
Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree
Answer:
D
Explanation:
The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria
Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used? Choose all that apply.
A. He crossed true-breeding pea plants.
B. He allowed eggs to be fertilized only by self-pollination.
C. He analyzed his data mathematically.
D. He controlled variables by studying one or two traits at a time.
The research practices Mendel used is applies including A, B and C.
What is Mendel's experiment?
Mendel studied inheritance in peas (Pisum sativum). He chose peas because pea plant are easy to grow and can be sown each year. Pea flowers contain both male and female parts, called stamen and stigma, and can usually self-pollinate.
Mendel studied the inheritance of 7 traits in pea plants including height, flower color, seed color, and seed shape and each trait had 2 forms. He identified pure-breeding pea plants that consistently showed 1 form of a trait after generations of self-pollination.
Mendel proposed a theory of inheritance, based upon the observed data during his experiments, and a mathematical analysis of his results,
Thus, from above, the correct options include A, B and C whereas D doesnt apply because Mendel studied 7 traits at a time.
Learn more about Mendel' experiment, here; https://brainly.com/question/3056662
#SPJ2
Help stepbro im stuck in the washer
Answer:
I'LL HELP YOU......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................NOT
The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it
Answer:
A) make new cells(somatic cells)and only germ-line cells do it(meiosis)
Explanation:
Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.
While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.
Meiosis produces germ cells while mitosis produces somatic cells.
What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%
Answer:
90%
Explanation:
In pea plants, purple flowers (P) are dominant over white flowers (P). If two heterozygous purple flowered plants are
crossed with each other, then what are the possible genotypes of the offspring?
0
Answer is pp only
Answer :the answer is D
Explanation:
how does a liver cell respond to insulin
Answer:
Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.
Explanation:
Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.
How can a small mutation provide a small advantage to an organism?
Answer:
It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.
Hope this helps!
Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks
Answer:
Bacteria
Explanation:
Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.
Sunlight, rocks, and soil are all non-living.
The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.
They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.
Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.
Learn more about soil at:
https://brainly.com/question/31227835
#SPJ6
what does the tilde symbol mean in biology
Answer:
means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".
What is the formula to find out the energy when given the energy?
You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele
Answer:
Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )
Explanation:
The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.
The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ). hence option D is the correct answer.
Describe the steps a plant would take to move sugars from a source to a sink.
answer and show proof for brainliest
Answer:
C- South America. Because South America is mostly rain forest and forests in the northern and mid section of it.
Explanation:
The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: *
A. pituitary gland
B. thyroid gland
C. pancreas
D. adrenal gland
Answer:
The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: thyroid gland.
The largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.
What do you mean by Endocrine Gland?An endocrine gland may be defined as a type of gland which consists of several organs that make hormones and release them directly into the blood so they can travel to tissues and organs all over the body. These hormones control many important functions in the body, including growth and development, metabolism, and reproduction.
The pancreas is the largest endocrine gland that significantly makes three hormones namely, Insulin, Glucagon, and Somatostatin. These hormones are actively involved in the regulation of metabolism by numerous mechanisms.
For example, insulin lowers the level of sugar in the blood, while glucagon increases the level of sugar by transforming its storage form.
Therefore, the largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.
To learn more about Endocrine glands, refer to the link:
https://brainly.com/question/4455660
#SPJ2
Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver
Answer:
The pancreas
Explanation:
it happens when the pancreas doesnt produce enough of something called insulin
How do invasive species usually affect the availability of natural resources in an ecosystem?
PLEASE HELP ME
Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.
Explanation:
"In rabbits, B = black fur and b = white fur. If fur color is an incomplete dominance trait, what phenotype will a
heterozygous rabbit show?"
Answer:
b is the answer my friend. hope this will solve your problem. mark me as brainliest
the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles
I need help ASAP!!
A.D
B.B
C.C
D.A
Answer:
a ibecause tifmsndtbeekodfhekekn
Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids
Answer:
The correct answer is - proteins.
Explanation:
All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.
Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.
The changes that occurred in Yellowstone National Park after all of its wolves
were killed showed that wolves are
A. harmful to the ecosystem
B. the only producers in the ecosystem
C. beneficial to the ecosystem
a
D. unnecessary for the survival of other species
Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.
Answer:
Liver phosphorylase a concentration decreases when glucose enters the blood.
The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form
As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form
Explanation:
Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase a is converted (and inactivated) into the b form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase a, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase a.
What is the major distinction scientists use to divide the animal kingdom?
Answer:
Whether the animal has a vertebral column or not.
If making a protein was like making a building, then the DNA molecule is like the blueprints and the RNA molecules are like the construction workers
True
False
How many hydrogen bonds are present in the base pairing of guanine and cytosine?
3
Answer:
3 Hydrogen bonds
Explanation:
Cytosine and guanine pairing can be found in both DNA and DNA-RNA hybrid formed during replication and transcription. The two nitrogenous bases are held together by three hydrogen bonds.
Please help, A, B,C, or D?
Answer:
I cant see the pic??
Explanation:
how is zero, oxidation numbers, and noble gases related
Of its valence electrons or the no. Of valences in its Valence shell .In case of noble gases, their outermost shell is absolutely crammed so no emptiness is available in the outer maximum shell. Thus the oxidation kingdom is 0(zero)for Noble gases. Because, they've complete electrons in their out maximum shell.
hope this helps
Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA
Answer:
The correct answer is -
a single strand with a distinctive cloverleaf structure, and
tRNA
Explanation:
The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.
Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.