In the bacterial transformation experiment, what is the primary purpose of using an ampicillin-containing medium?
to select for transformed cells
to select for wildtype cells
to prevent contamination
to stimulate a color change

Answers

Answer 1

The primary purpose of using an ampicillin-containing medium in a bacterial transformation experiment is a. to select for transformed cells

In a bacterial transformation experiment, the main goal of employing an ampicillin-containing media is to select for transformed cells. Ampicillin is an antibiotic that prevents bacteria from growing by disrupting the formation of their cell walls. Researchers frequently insert a plasmid harbouring an ampicillin resistance gene into the bacterium as part of a transformation experiment.

The only bacteria that can live and thrive in the presence of ampicillin are those that successfully take up the plasmid and transform. As a result, the ampicillin-containing media functions as a selective agent, enabling the separation of the altered cells from the population and their identification.

Read more about ampicillin on:

https://brainly.com/question/14867144

#SPJ4

Complete Question:

In the bacterial transformation experiment, what is the primary purpose of using an ampicillin-containing medium?

a. to select for transformed cells

b. to select for wildtype cells

c. to prevent contamination

d. to stimulate a color change


Related Questions

alpha-defensins and reactive oxygen species (ros) are examples of anti-microbial molecules produced by professional phagocytes, which can function by breaking down and killing phagocytosed pathogens. True or false

Answers

True. Alpha-defensins and reactive oxygen species (ROS) are examples of anti-microbial molecules produced by professional phagocytes, which can function by breaking down and killing phagocytosed pathogens

Alpha-defensins and reactive oxygen species (ROS) are indeed examples of antimicrobial molecules produced by professional phagocytes, such as neutrophils and macrophages. These molecules play a crucial role in the immune response against invading pathogens.

Alpha-defensins are small peptides that possess antimicrobial properties. They can directly kill microorganisms by disrupting their cell membranes, leading to their lysis or death. These defensins are produced by various immune cells, including neutrophils, and contribute to the elimination of pathogens during phagocytosis.

Reactive oxygen species (ROS), including superoxide anion, hydrogen peroxide, and hypochlorous acid, are generated by phagocytes during the process of phagocytosis. ROS are highly reactive molecules that can damage microbial components, such as proteins and DNA, leading to the killing or inactivation of phagocytosed pathogens.

Therefore, both alpha-defensins and reactive oxygen species are antimicrobial molecules produced by professional phagocytes that function by breaking down and killing phagocytosed pathogens.

To know more about alpha-defensins  follow the link:

https://brainly.com/question/31415238

#SPJ4

what is the relationship between the rate of wind and the amount of abrasion?

Answers

Answer: Wind speed is also important. The rate of erosion caused by a 30-mile-per-hour wind is more than three times that of a 20-mile-per-hour wind. Wind erosion decreases as soil moisture increases. For example, dry soil erodes about one-and-one-third times more than soil with barely enough moisture to keep plants alive.

Explanation:

https://www.agry.purdue.edu/soils_judging/new_manual/ch6-wind.html Hope this helps

State the most probable cause for each of the following scenario:

A student is having difficulty interpreting the reagent strip color reactions on a thick orange specimen.

Answers

The most probable cause for a student having difficulty interpreting the reagent strip color reactions on a thick orange specimen is a large amount of urobilinogen.

What are reagent strips?

Reagent strips, also known as urine dipsticks, are used to check for various substances in urine. They are thin, plastic strips with pads on the end that are coated with chemicals that react with substances in the urine.

When urine comes into touch with the pads on the reagent strips, the chemical coating on the pads changes color to indicate the presence of particular substances in the urine. The colors of the pads on the strips are compared to a color chart to determine the amounts of substances in the urine.

Therefore, if a student is having difficulty interpreting the reagent strip color reactions on a thick orange specimen, the most probable cause is a large amount of urobilinogen. Orange or brown urine with a high amount of urobilinogen, which is caused by an excessive breakdown of red blood cells, might cause the color of the specimen to become thick orange. This might make it tough for a student to interpret the color reactions of the reagent strips.

Learn more about reagent strip: https://brainly.com/question/32403321

#SPJ11

which of the following would not be a teratogen? question 18 options: cigarettes lead rubella (german measles) steak

Answers

The following would not be a teratogen among cigarettes, lead, rubella (german measles), and steak is steak. Teratogens are substances that interfere with prenatal development and can lead to birth defects. Cigarettes, lead, and rubella are known teratogens that can cause significant harm to a developing fetus. However, steak is not a teratogen.

Cigarettes are a teratogen because they contain harmful chemicals that can cross the placenta and interfere with fetal development. These chemicals can increase the risk of low birth weight, premature birth, and birth defects such as cleft palate and heart defects.

Lead is also a teratogen because exposure to high levels of lead during pregnancy can lead to developmental delays, learning disabilities, and other cognitive impairments in children. Lead can be found in contaminated water, soil, and household items such as paint and dust.

Rubella, or German measles, is another teratogen that can cause severe birth defects if a woman becomes infected during pregnancy. Rubella can cause deafness, blindness, heart defects, and intellectual disability in a developing fetus.

Steak, on the other hand, is not a teratogen. While some types of food, such as undercooked meat and raw eggs, can be harmful during pregnancy due to the risk of foodborne illness, properly cooked steak is not a teratogen and does not pose a risk to fetal development.

know more about Teratogens click here:

https://brainly.com/question/28815393

#SPJ11

Can humans turn into fossils why or why not?

Answers

Answer:

Certain types of animals are more likely to end up as fossils. ... On the other hand, it turns out humans are actually fairly well-suited to becoming fossils. “Mammals have a very good record, because teeth make fantastic fossils,” says Norell. “They're incredibly hard, incredibly resilient.  

Explanation:

Answer:

well probably we humans are almost, practically fit for fossils so we have a chance to turn into a fossil

Explanation:

Why do some organisms produce many more offspring than other organisms?

Answers

some animals have multiple offspring , like fish and turtles , in hopes that at least some of them will survive. These organisms that have large amount of offspring usually dont give extensive or any care in raising the offspring. They just hope that at least a couple survive to pass on their genes.
Organisms that only have a few offspring (ei monkeys, birds, humans, mammals in general) usually devote a large amount of care into raising their offspring. Most often the mother and the father raise the offspring, and the offspring has a very high chance of survival.
Both of these mechanisms are just to ensure the passing of genes.
Hope that helped XD

I
rupe de estudiante utiliza un aparate para estudia
reaction quimica entre pedande cascara de bo
acetico, me muestra la siguiente ilustracion
ar la transferencia de energia durante la
de camara de hormierhonate de calcio vare
Experimento con vinagre y cáscara de huevo
Burbujas
Burbujas
Burbujas
de
Tubo
de
vidrio
Tubo
de
vidrio
vidno
Cáscara de
huevo
Vinagre
Cáscara de
huevo
Vinagre
3
Cáscara de
huevo
Vinagre
5%
Durante el experimento, utilizan la misma masa de cascara de huevo, pere varian la
concentración del vinagre.
A. Explica por yue la transferencia de energia no es la misma entre las tres pruebas del
experimente
B. Describe como se podria modificar el aparato para que pueda medir con MAYOR
EXACTITUD la transferencia de energia en cada reacción.
Recuerda contestar todas las partes de la pregunta en el espacio previsto​

Answers

A. La transferencia de energía no es la misma entre las tres pruebas del experimento debido a la variación en la concentración de vinagre.

La concentración del vinagre influye en la velocidad y la eficacia de la reacción química. El vinagre es una solución diluida de ácido acético en agua, y el ácido actúa para disolver la capa externa de carbonato de calcio que compone la cáscara del huevo. Cuanto mayor sea la concentración de ácido acético en el vinagre, más rápida será la reacción y mayor será la transferencia de energía. Por lo tanto, se puede observar que la prueba que utilizó la concentración de vinagre al 10% tuvo una transferencia de energía mucho más alta que las otras dos pruebas.B.

El aparato se puede modificar para medir con mayor exactitud la transferencia de energía en cada reacción. Esto se puede hacer utilizando un calorímetro, que es un dispositivo que se utiliza para medir el calor de las reacciones químicas o los cambios físicos. El calorímetro consta de un recipiente aislado que contiene una muestra y se coloca en un baño de agua. Se mide la temperatura del agua antes y después de la reacción, y la diferencia en la temperatura se utiliza para calcular la cantidad de calor absorbido o liberado por la muestra.

To know more about tres  visit:

https://brainly.com/question/1098271

#SPJ11

cystic fibrosis is a genetic disease that leads to the production of excessive thick mucus in the respiratory tract, leading to frequent and serious respiratory infections. the defect is due to the production of a faulty membrane protein for the transport of the chloride ion. the protein is still in the membrane; it just doesn't function normally. what type of membrane protein is being affected in this case?

Answers

The type of membrane protein that is affected in cystic fibrosis is a chloride ion channel.

What is Cystic fibrosis?

Cystic fibrosis is an inherited condition in which the mucus in the body becomes thick and sticky. It can cause breathing difficulties and frequent infections, among other symptoms. Because the mucus is thicker than normal, it can obstruct the ducts of the pancreas, preventing digestive enzymes from reaching the small intestine.Cystic fibrosis is an autosomal recessive genetic disorder.

This means that in order to inherit the disease, a person must inherit two copies of the mutated gene, one from each parent.

What is the cause of cystic fibrosis?

Cystic fibrosis is caused by a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The CFTR gene provides instructions for making a protein called the cystic fibrosis transmembrane conductance regulator. This protein functions as a chloride ion channel, which helps regulate the flow of salt and fluids in and out of cells.

However, in people with cystic fibrosis, the CFTR protein is either missing or not functioning properly due to a genetic mutation. As a result, the salt and water balance is disrupted, leading to the production of thick, sticky mucus that clogs the airways, digestive tract, and other ducts in the body.

To know more about cystic fibrosis, refer here:

https://brainly.com/question/31366825#

#SPJ11

How might change in one population affect other populations?

Answers

The food chain will mess up.

I Will Mark Brainliest

Which of the following is the broadest taxonomic category?
A
phylum
B
class
C
genus
D
domain

Answers

Answer:

I think it's A- phylum, hope this helps

The broadest taxonomic category is Domain

3. Which organism has DNA located in three organelles?
A. A sponge
B. A fern plant C. A flatworm
D. A bacterium

Answers

The answer is B). A fern plant

In a FERN PLANT, DNA is located in three different organelles (Option B).

Plants are organisms that have chloroplasts, mitochondria, and cell nuclei.

In a eukaryotic cell, the genetic material (i.e., DNA) is mainly found in the nucleus, which is an organelle bounded by a double-membrane (bacteria don't have nuclei).

However, mitochondria and chloroplasts are also membrane-bound organelles that have their own genetic material.

Chloroplasts are only found in plants and algae (sponges and flatworms don't have chloroplasts).

In conclusion, in a FERN PLANT, DNA is located in three different organelles (Option B is correct).

Learn more in:

https://brainly.com/question/11136550?referrer=searchResults

1. Explain why the greenhouse effect is necessary but how an enhanced greenhouse effect can harm the planet.
2. Define global warming and explain what has caused the recent trend of warming that the earth is experiencing.
3. Explain why Earth's temperature is directly affected by the amount of greenhouse gases in the atmosphere.
4. Define carbon sequestration and explain how deep geologic burial of carbon works.
5 Describe the connection between fossil fuel burning, the melting of polar ice, and the rising of global sea levels.

Answers

Answer:

1. The enhanced greenhouse effect disrupts the Earth's climate equilibrium and has led to an increase in the global average surface temperatures.

2. Scientists attribute the global warming trend observed since the mid-20th century to the human expansion of the "greenhouse effect"   1 — warming that results when the atmosphere traps heat radiating from Earth toward space. Certain gases in the atmosphere block heat from escaping.

3. Greenhouse gases absorb some of the energy and trap it in the lower atmosphere. Less heat radiates into space, and Earth is warmer. ... Carbon dioxide, methane, water vapor, and nitrous oxide are naturally present in Earth's atmosphere.

4. Carbon sequestration is the process of capturing and storing atmospheric carbon dioxide. It is one method of reducing the amount of carbon dioxide in the atmosphere with the goal of reducing global climate change.

5. As climate change caused by burning fossil fuels drives temperatures higher, the ocean warms, causing it to expand. ... Scientists have found that water draining from melting glaciers and ice sheets in polar and mountain regions is now also contributing to this rise in sea levels.

Answer: 1. Necessary because it keeps heat in and keeps the planet at the right temperature for life.

It can harm the planet if more pollution occurs and the greenhouse gas effect traps too much heat and causes global warming. 2. Scientists attribute the global warming trend observed since the mid-20th century to the human expansion of the "greenhouse effect"1 — warming that results Greenhouse gases let the sun's light shine onto the Earth's surface, but they trap the heat that reflects back up into the atmosphere. In this way, they act like the insulating glass walls of a greenhouse. The greenhouse effect keeps Earth's climate comfortable when the atmosphere traps heat radiating from Earth toward space. Certain gases in the atmosphere block heat from escaping. 3. Human activities contribute to global warming by increasing the greenhouse effect. ... Greenhouse gases let the sun's light shine onto the Earth's surface, but they trap the heat that reflects back up into the atmosphere. In this way, they act like the insulating glass walls of a greenhouse. 4. Carbon sequestration is the process of capturing and storing atmospheric carbon dioxide. It is one method of reducing the amount of carbon dioxide in the atmosphere with the goal of reducing global climate change. Geologic carbon sequestration is the process of storing carbon dioxide (CO2) in underground geologic formations. The CO2 is usually pressurized until it becomes a liquid, and then it is injected into porous rock formations in geologic basins. 5. As climate change caused by burning fossil fuels drives temperatures higher, the ocean warms, causing it to expand. This expansion in turn causes sea levels to rise. ... There is now so much warming baked in to the global climate system that sea levels will continue to rise for centuries.

Explanation:

What causes the change from day to night and vice versa?

A. The orbit of the sun around Earth.
B. The moon's rotation around Earth
C. The rotation of Earth on its axis.
D. The orbit of Earth around the sun

Answers

Answer:

c? if u stand infront a light and spin, the opposite side to the light would be dark?

C,the rotation of earth on its axis

What are all of the secondary consumers included in this web?Herring


Sprat


Gray seal


Saduria entomon


Monoporeia affinis

Answers

Answer: Herring and Gray Seal.

Why? Without the image it’s hard to really tell without the picture of the web, however, it seems to me that the sprat would eat the Saduria thing and the Monporeia and the Seal and herring would eat the Sprat making them the secondary consumers.

Hope this helps

How do toothed whales produce echolocating sounds?

Answers

Answer:

Toothed whales (including dolphins) have developed a remarkable sensory ability used for locating food and for navigation underwater called echolocation. Toothed whales produce a variety of sounds by moving air between air-spaces or sinuses in the head.

Explanation:

Answer:

Toothed whales can direct sound by bouncing it off air sacs in their nose and possibly by using face muscles to alter the shape of the melon.

Explanation:

Light traveling through the air moves in a straight line. An object viewed through water looks different because light rays that travel through water are . . .
A.bent
B.reflected
C.bounced
B.absorbed

Answers

I think The correct answer is c
the answers B , reflected

7. Based on what you know about Carbon Dioxide (look at the definitions section) and the Description of the Landscapes, how did the amount of Carbon Dioxide in the atmosphere increase over time? 8. Carbon Dioxide and Water vapor are greenhouse gases. How do greenhouse gases act like the glass in greenhouses?​

Answers

Answer: Carbon dioxide levels today are higher than at any point in at least the past 800,000 years. Global atmospheric carbon dioxide concentrations (CO2) in parts per million (ppm) for the past 800,000 years. ... Carbon dioxide concentrations are rising mostly because of the fossil fuels that people are burning for energy. The large numbers of land animals raised to feed the Earth's growing population results in increased carbon dioxide levels in the atmosphere due to farming practices and respiration and methane production. This is another example of how human activity indirectly affects biogeochemical cycles in a significant way.  8. Gases in the atmosphere, such as carbon dioxide, trap heat similar to the glass roof of a greenhouse. These heat-trapping gases are called greenhouse gases. During the day, the Sun shines through the atmosphere. Earth's surface warms up in the sunlight. Greenhouse gases let the sun's light shine onto the Earth's surface, but they trap the heat that reflects back up into the atmosphere. In this way, they act like the insulating glass walls of a greenhouse.

Explanation:

Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]
5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3´

Answers

The correct mRNA sequence transcribed from the given DNA sequence is: 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' Here option B is the correct answer.

To determine the correct mRNA sequence transcribed from the given DNA sequence, we need to apply the rules of DNA transcription. During transcription, the DNA sequence is used as a template to synthesize an mRNA molecule, with the RNA base uracil (U) substituting for thymine (T) in the DNA.

The given DNA sequence is:

5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'

To transcribe this DNA sequence into mRNA, we replace each DNA base with its RNA counterpart:

G (Guanine) → C (Cytosine)

C (Cytosine) → G (Guanine)

A (Adenine) → U (Uracil)

T (Thymine) → A (Adenine)

Applying these conversions, we get the mRNA sequence:

5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'

Therefore, option b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' represents the correct mRNA sequence transcribed from the given DNA sequence.

To learn more about mRNA

https://brainly.com/question/29314591

#SPJ4

Complete question:

Which of the following represents the correct mRNA sequence transcribed from the given DNA sequence?

a) 5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'

b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'

c) 5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'

d) 5' GGGATCGATGCCCCTTAAAGAGUUUACAUUAUUGCUGGAGGCGUUAACCCCGGA 3'

4. The diagram below represents one possible immune response that can occur in the human body.
**The structures that are part of the immune system are represented by
A, only
A and C, only
B and C, only
A, B, and C

5. Explain your answer to the previous question

Answers

Answer:

A and C only

Explanation:

I'm sorry I don't know how to explain it but trust me its A and C only.

Enzymes are composed of what organic molecule?
a. sugars
b. DNA
c. proteins
d. lipids

Answers

Answer:

Proteins

Explanation:

Among the organic macromolecules, enzymes belong in the category of proteins. Proteins are distinct from carbohydrates, nucleic acids, and lipids in that a protein is made of amino acids. Amino acids link together into a chain that can fold into a three-dimensional shape.

The nucleotides on the mRNA will be "read" in the next step to producing a polypeptide. What sequence of bases indicates the starting point for the polypeptide "blueprint"?

Answers

The sequence of bases on mRNA that indicates the starting point for the polypeptide "blueprint" is called the start codon. In most cases, the start codon is AUG, which codes for the amino acid methionine.

During the process of translation, the ribosome binds to the mRNA molecule and scans along its sequence until it reaches the start codon. The start codon serves as a signal for the ribosome to initiate protein synthesis. Once the ribosome recognizes the start codon, the process of translation begins, with subsequent amino acids being added to the growing polypeptide chain according to the sequence of codons on the mRNA.

It is important to note that while AUG is the most common start codon, there are also alternative start codons in certain cases. For example, GUG and UUG can function as start codons in some organisms or under specific conditions.

The start codon, typically AUG, marks the beginning of the protein-coding region on the mRNA and serves as the starting point for the synthesis of a polypeptide chain during translation.

To learn more about polypeptide, visit:

brainly.com/question/28270191

#SPJ11

Explain the difference between DNA, chromosomes, genes, and the protein that is created.

I NEED THIS QUICKLY PLS!!!

Answers

DNA contains the instructions, genes, to make proteins that tell what genetic traits the person will have. The DNA along with the proteins make up the chromosomes. The chromosomes are then passed on to the offspring, and with the DNA inside the chromosomes and translation of the genes, its traits are decided. Genes are made up of strains of proteins called amino acids

Explanation:

DNA is a long molecule that contains our unique genetic code.DNA is composed of two strands that wrap around each other to form a double helix shape.

Genes are sections of DNA that contain the set of instructions to produce one specific molecule in your body, usually a protein. These proteins control how our body grows and works; they are also responsible for many of our characteristics, such as our eye colour, blood type or height.

Chromosomes are bundles of tightly coiled DNA located within the nucleus of almost every cell in our body. Humans have 46 chromosomes . We inherit one set of 23 chromosomes from our mother and one set of 23 chromosomes from our father. So we have two sets of 23 chromosomes or 23 pairs.

The diagram below shows the first four steps of meiosis.what's is happening in step labeled c?

Answers

D is the correct answer

A scientist observes the cells of a newly discovered organism under a microscope. The organism has mitochondria, a cell wall, lysosomes, and ribosomes. Is this organism a plant or an animal, and how do you know? A. The organism is a plant, because it has lysosomes. B. The organism is an animal, because it has mitochondria. C. The organism is a plant, because it has a cell wall. D. The organism is an animal, because it has ribosomes.​

Answers

Answer:

think the answer is:

C. The organism is a plant because it has a cell wall.

Explanation:

only plant cells have Cell Walls

Human Eye ModelExperiment 1: Optics of the Human Eye Part 2: Accommodation In the process of accommodation, muscles in the eye change the shape of the crystal- line lens to change its focal length. Initially, you will model accommodation by vary- ing the focal length of the crystalline lens using the adjustable focus lens. Later, when the model is filled with water, accommodation is achieved by replacing the crystalline lens with fixed lenses of various focal lengths. Procedure Note: If you have not done so yet, follow the instructions of page 5 to fill the adjustable focus lens with water. 1. Do not fill the eye model with water yet. Replace with lens in the SEPTUM slot with the adjustable focus lens. Position the eye model about 25 cm from the illu- minated screen Can you see the image on the retina? Move the syringe plunger to adjust the lens and form the clearest image possible. Is the lens concave or convex? Is it a converging lens or a diverging lens? 2. Move the eye model farther from the illuminated screen to about 50 cm. Adjust the lens again to form the clearest image. Did you increase or decrease the power of the lens? Did you increase or decrease the focal length? 3. Replace the adjustable focus lens with the +400 mm lens in the SEPTUM slot. Adjust the distance of the illuminated screen to form a clear image. Mark the position of the eye model so you can retum it to the same place after you fill it with water. 4. Fill the eye model with water to within 1 or 2 cm of the top. Return it to the same position as in step 3. Is the image still in focus? Try changing the distance, can you get it to focus? Explain what effect do the aqueous and vitreous humors (modeled by the water) have on the focal length of the eye's lens system? 5. Place the eye model about 35 cm from the light source, Replace the +400 mm lens in the SEPTUM slot with the +62 mm lens. Is the image in focus now? Move the eye model as close as possible to the light source while keeping the image in focus. Describe the image on the retina screen 6. Measure the object distance, o, from the screen of the light source to the top rim of the eye model, as pictured below. (The front of the rim is a convenient place to measure to and marks the center of the eye model's two-lens system.) Record this distance, which is the near point of the eye model when equipped with the +62 mm lens. The average human eye has a near point for distinct vision of about 25 cm tak +62 mm Lens

Answers

The experiment demonstrated the adjustments needed for achieving a clear image in the optics of the human eye model. The lens selection, positioning, and introduction of water mimicked the effects observed in a real eye.

Experiment 1: Optics of the Human Eye

1. The lens in the SEPTUM slot is replaced with the adjustable focus lens. The eye model is positioned about 25 cm from the illuminated screen.

If the image is not visible on the retina, the syringe plunger is moved to adjust the lens and to create the clearest image possible. The lens is convex and is a converging lens.

2. The eye model is moved farther from the illuminated screen to approximately 50 cm. The lens is adjusted to create the clearest image. The power of the lens has decreased, and the focal length has increased.

3. The adjustable focus lens is replaced with the +400 mm lens in the SEPTUM slot.

The distance between the illuminated screen and the eye model is adjusted to produce a clear image. The position of the eye model is marked so that it can be returned to the same position after it is filled with water.

4. The eye model is filled with water to approximately 1-2 cm from the top. It is returned to the same position. The image is still in focus. It is possible to adjust the distance to obtain a focused image.

The aqueous and vitreous humors, represented by water, have a significant impact on the eye's lens system's focal length. They serve to improve the focal length of the lens by providing a uniform refractive medium for the light to pass through.

5. The eye model is positioned roughly 35 cm from the light source. The +400 mm lens in the SEPTUM slot is replaced with the +62 mm lens. The image is in focus now.

The eye model is brought as near to the light source as possible while still keeping the image in focus. The image on the retina screen is vivid.

6. The object distance is measured from the screen of the light source to the top rim of the eye model. The near point of the eye model is around 25 cm when using a +62 mm lens. The near point of a human eye is about 25 cm, indicating that the eye model is a good representation of a real eye.

Learn more about optics : brainly.com/question/18300677

#SPJ11

 HURRY I HAVE A TIME LIMIT!

Humans, cats, whales, and bats all have similar arm bones. What piece of evidence for common ancestry does this describe?

-homology
-embryology
-fossil record
-amino acids sequences

Answers

Answer: that they all have the bones used to make their movements so they can live and survive on there own.

Explanation:

Why do the temperatures change over the months?
O A. Because the Moon is tilted on its axis, it reflects more sunlight on Earth during different times of Earth's yearly orbit.
B. Because the Sun is tilted on its axis, parts of Earth get more sunlight during different times of Earth's yearly orbit.
O C. Because Earth is tilted on its axis, the stars reflect more light during different times of the Earth's yearly orbit.
D. Because Earth is tilted on its axis, parts of Earth get more hours of sunlight during different times of Earth's yearly orbit.

Answers

Answer:

Answer

Explanation:

B because the more the sun is titled the more heat=different season.

Because Earth is tilted on its axis, parts of Earth get more hours of sunlight during different times of Earth's yearly orbit. As Earth orbits around the Sun, its axis is tilted at an angle of about 23.5 degrees. Hence the correct option is D.

Why do the temperatures change over the months?

The temperatures change over the months primarily because of Earth's axial tilt. As the Earth rotates around the sun, the angle at which sunlight hits different parts of the Earth changes.

This is because the Earth's axis is tilted about 23.5 degrees relative to its orbit around the sun. When a particular hemisphere is tilted toward the sun, it receives more direct sunlight, resulting in warmer temperatures.

Conversely, when that hemisphere is tilted away from the sun, it receives less direct sunlight, resulting in cooler temperatures. This cycle repeats itself annually, causing changes in temperatures over the months.

Hence the correct option is D.

To know more about Earth's axis:

https://brainly.com/question/14639935

#SPJ2

write the two functions of blood?​

Answers

Explanation:

regulating body temperature

forming blood clots to prevent excess blood loss

What are the factors that increase a species success over time.

Answers

Answer:

Explanation:

(1) the potential for a species to increase in number,

(2) the heritable genetic variation of individuals in a species due to mutation and sexual reproduction,

(3) competition for limited resources

(4)  the proliferation of those organisms that are better able to survive and reproduce in the environment

Hope this helped!!!

What do tornadoes and hurricanes have in common

Answers

☁️ Answer ☁️

"Tornadoes and hurricanes appear to be similar in their general structure. Both are characterized by extremely strong horizontal winds swirling around the center, strong upward motion dominating the circulation with some downward motion in the center. "

1. Death

2. strong horizontal winds swirling around the center

3strong upward motion dominating the circulation with some downward motion in the center.

Hope it helps.

Have a nice day noona/hyung.

Other Questions
differential diagnoses for consideration when suspecting a agoraphobia disorder include all the following except: A cost that requires a future outlay of cash, and is relevant for current and future decision making, is a(n):a) Out-of-pocket cost.b) Sunk cost.c) Opportunity cost.d) Operating cost.e) Uncontrollable cost. Suppose you have a market for baseballs which is currently in equilibrium. Thinking of the supply and demand graph for this market, what would have to happen to cause both the equilibrium quantity of baseballs in this market to fall and the equilibrium price of baseballs in this market to fall? given the array-based list (20, 12, 24, 25), what is the output of arraylistsearch(list, 25) Prior to recording the following, Elite Electronics, Inc., had a credit balance of $2,800 in its Allowance for Doubtful Accounts. a. On August 31, a customer balance for $380 from a prior year was determined to be uncollectible and was written off b. On December 15, the customer balance for $380 written off on August 31 was collected in full. Required: For each transaction listed above, indicate the amount and direction (+ for increase, - for decrease) of effects on the financial statement accounts and on the overall accounting equation. Hint: On December 15th, first reinstate the Accounts receivable and then record the collection of cash. (Enter any decreases to Assets, Liabilities, or Stockholders Equity with a minus sign.) Identify the neutral element represented by this excitedstate electron configuration.excited state: 1s2 2s2 2p6 3s2 3p1 4s1Element symbol = ?Write the full groundstate electron configuration for that element.Ground state = ? Many not-for-profit (NFP) organizations are charitiesthat collect funds for special purposes. An example would be aresearch foundation that seeks a cure for cancer. To protectinvestors, business or Which of the following are considered to be the toxic effects of a drug?a. Additional, mild, unwanted effectsb. Unusual, unexpected mild effectsc. Serious, possibly life-threatening effectsd. Reduction of the allergic response what are some things Esperanza learns about the camp Pennsylvania. The Pennsylvania office has a lease that is expiring in eight months. They plan on leasing and building out an office in a new business park INSTRUCTIONS: 1) CREATE a Risk event audit: R Draw the Lewis structure for SO (by following the octet rule on all atoms) and then determine the number of nonbonding electron pairs on the central atom. what is the difference between american and indonesia commercialbanks ?- system/ how it works- comparassion- superior products and services to attract customers Required information [The following information applies to the questions displayed below] Carmen Camry operates a consulting firm called Help Today, which began operations on December 1. On December 3 diagram and discuss the healing from a national newspaper lastweek: "Peloton to Raise Price of Bikes and Treadmills as DemandSlows" Show that ^2 = SSE/n, the MLE of ^2 is a biased estimator of ^2? Round the final Next Sparkle Jewelry sells 400 units resulting in $7,000 of sales revenue, $4,000 of variable costs, and $1,500 of fixed costs. Contribution margin per unit is answer to the nearest cent.) A. $7.50 B. $21.25 C. $3.75 D. $17.50 Everyday the weather is being measured. According to the results of 4000 days of observations, it was clear for 1905 days, it rained for 1015 days, and it was foggy for 1080 days. Is it true that the data is consistent with hypothesis $H_0$: the day is clear with probability 0.5, it rains with probability 0.25, fog with probability 0.25, at significance level 0.05 ? Please help5. Which term of the geometric sequence 1, 3, 9, ... has a value of 19683? HURRY PLEASE HELP IN THE NEXT FIVE MINUTESRead the scenario.Darcy is running for governor. She meets with a super PAC of educators, and they are impressed with her ideas for funding schools. How could the super PAC support Darcy?A) by financing a series of ads about her ideasB) by raising money for her campaignC) by giving her a large sum of money D) by paying for her campaigns travel expenses Answer the following question in a couple of sentences. When comparing with a partnership, what are some of the advantages of forming a corporation? Give some examples.