mean median mode

4, 7, 10, 7, 14, 6, 0, 2, 9, 5, 3, 4

Answers

Answer 1
This is the answer I got
Mean Median Mode4, 7, 10, 7, 14, 6, 0, 2, 9, 5, 3, 4
Answer 2
mean- 35.5
median- 6
mode- 7
i think :)

Related Questions

Annabella swam for 2 3/4 hours, macyn swam 1 6/8 hours less than Annabella, seth swam 1 2/3 hours longer than macyn, Jaden swam as long as Annabella and Seth combined, Ricardo swam 6/9 of an hour longer than seth. How long did each kid swim.

Answers

Answer:

Annabella swam for 2 hours and 45 Minutes. Macyn swam for 1 hour. Seth swam for 2 hours and 40 minutes. Jaden swam for 5 hours and 25 minutes. Ricardo swam for i believe 3 hours and 20 minutes. Jaden swam the longest and all of them together swam for: 910 minutes. AKA 15 hours and 10 minutes

Step-by-step explanation:

That was a lot of work please mark brainliest :)

I WILL ANSWER SO THE OTHER PERSON CAN GET BRAINLIEST:D
HOPE YOU HAVE A NICE DAY/NIGHT!

Which describes all decimals that are rational numbers?
A. the decimal terminates or repeats.
B. the decimal terminates and does not repeat.
C. the decimal neither terminates nor repeats.
D. the decimal repeats and does not terminate.

Answers

Answer: A. the decimal terminates or repeats.

===========================================================

Explanation:

A terminating decimal example would be something like 0.2 which converts to the rational number, aka fraction, 1/5. The word "terminate" means "stop", so it's any decimal that doesn't go on forever.

A repeating decimal is something like 0.33333 where the 3s go on forever, and that converts to 1/3.

If any of these conditions happen, then the number is rational.

--------

For something like pi = 3.14159... where there isn't a pattern and it goes on forever, then we consider this number irrational. The term "irrational" literally means "not rational". So this allows us to rule out choice C.

Choices B and D are partially true, but they only paint half the picture needed to form all rational numbers. Choice A is the most complete statement.

In other words, while choice B is technically true, it leaves out repeating decimals. Choice D is the same way but it leaves out terminating decimals. So we can rule out choices B and D.

The answer is aaaaaaaaaaaaaaaaaaaa

***no links please***

Answers

Answer:

3(pi)

Step-by-step explanation:

8.33 (repeating 33) is 8.333333...

3(pi) = 9.42477796...

17/2 = 8.5

sqrt(64) = 8

Answer: 3(pi)

Answer:

3 times pi

Step-by-step explanation:

8.33

pi times 3 is about 9

8.5

8

please help thank youuuu

Answers

Answer:

C

Step-by-step explanation:

I honestly took an educated guess

Negative association or correlations are defined by one variable increasing while the other is constantly decreasing. The correct answer is C

Which of the following triangles have three sides of different length?

A. acute
B. scalene
C.equilateral
D. right

Answers

Answer:

B. scalene

Step-by-step explanation:

A. acute - all angles are less than 90 degrees

B. scalene - all sides are different lengths

C.equilateral - all sides the same length

D. right- one angle is 90 degrees

Answer:

B

Step-by-step explanation:

Scalene Triangle A scalene triangle is a triangle in which all three sides are different lengths. Equilateral A polygon is equilateral if all of its sides are the same length

Hope this helps =)

7/15(x+4)+2/15(x+4)=7 1/5

Answers

Answer:

x = 59/3

Step-by-step explanation:

X=59/3
Download the app photo math and it will help

Mitra lives in San Francisco and takes a plane to Hawaii. When Mitra left the house it was -4°. When the plane landed in Hawaii, Mitra realized it was 32° hotter! What was the temperature when Mitra landed in Hawaii?

Answers

Answer:

28 degrees

Step-by-step explanation:

-4 + 32 = 32 - 4 = 28

hope this helped

28 degrees

All you need to do is add 32 to -4, or take 32-4

A fully loaded and fueled spacecraft can weigh close to 4.6 million pounds. What is this weight converted to​ tons?

Answers

the answer to your wis 2300
Spacecraft converted into tons would be 2,300

Do the ordered pairs (2, 20), (5, 15), (12, 19), and (14, 13) represent a function?

Answers

Answer:

yes

Step-by-step explanation:

Yes it does because the c values don’t repeat

which angles are supplementary to 14 ? select all that apply.

Answers

Answer will be 15>
Supplementary angles are two angles with the sun of 90 degrees
19 is supplementary to 14 :)

Quick, can someone help me, please?

Answers

Picture not clear enough.
not clear.. sorry, did you figure it out or still not?

Which angles are vertical to each other ? Select all that apply.

Answers

Answer:

angles 5 and 7

angles 2 and 4

angles 12 and 10

the answers are 5&7 and 10&12

Which expression has a value of 31 when x = 6, y = 10, and z = 11?
A.
3xyz

B.
2x + 3y – z

C.
4yz – 2x

D.
xy – 2z

Answers

C explanation I already did this question
the answer is B

2x 6=12
3x10=30
12+30=42
42-11=31

Can someone please help me answer this it's in the screenshots below

Answers

1) Monday
2) 13
3) 10
4) It starts at a higher temperature then slowly decreases, then increases again
5) On sunday the temperature was the lowest, this is because it is the lowest on the graph at 10
6) They should’ve added more numbers between to have a more clear answer
1)Monday
2)13
3)10
4)it start hot then goes down a little bit and the goes up on Friday and goes back down
5)it was on Sunday
6)by having more information about the temperature

my teacher took my pop tart-

Answers

Wow... Unbelievable Fire that teacher right now >:(
Just…… go buy another one. If you need assistance on which one to chose I personally like the strawberry one them things good.

HELP ASAP!!! (KHAN ACADEMY...USE IMAGES)

Answers

Answer:

8/3 is the unit rate of change

for graph: second point on the line coordinates will be (3,8)

8/3 = unit rate of change
(3,8) are coordinates

if the diameter of a disc is 50 ft, what will be the area of the disc?


Please help me on this.
i'm stuck on it.

Answers

Hey there! Your answer is:

1,963

Step-by-step explanation:

Please mark Brainliest<3

Yo I was stuck on this to but it is really simple it’s
1963

Please help!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

4. alternate exterior angles

5. 4.5

Alternate exterior angles 5.45 hope this helps

help plzzz...also give steps

Answers

Your answer is h=2 or the height is to hope this helped
answer = 2.5, i did 12.5 divided by 5 which got 2.5

Kiara has 39 yards of edging to pit around a garden. She uses all the edging to make 20 sections that are the same length. How long is each section,in yards.rounded total he near was st hundredth.

Answers

Answer:

1.95

Step-by-step explanation:

39 * 20

39 * 20 = 1.95

1.95

Because 39/20= 1.95

Which angles are supplementary to each other ? Select all that apply

Answers

Answer:

6 and 4

Step-by-step explanation:

Answer:

Choice 3: ∠5 and ∠6

Step-by-step explanation:

Supplementary means straight, and these two angles form a straight line when added together (angle measurements add up to 180)

Hope this helped :)

Need help, Don’t know what to put!!!!!

Answers

180 - 143 = 37
180 - 37 - 61 = 82

The answer is 82°

Answer:

84

Step-by-step explanation:

180° - 61° - 37°

180° is the sum of the 3 angles in any plane triangle. the 37 is reasoned from the picture

( Trigonometry question)
- will give branliest if it's the correct answer.-

Answers

Answer:

728.0067825

Step-by-step explanation:

Answer:

728 rounded

Step-by-step explanation:

i dnt know how I came up with the answer

Question: What is x????​

Answers

The answer for x will be 15

Answer:

x= 15

Step-by-step explanation:

because the other side is equal so you want to find what number times 3 will get you 45

iki has a piece of string that she cuts into smaller pieces. This line plot shows the lengths of the pieces. Raj has a piece of string that is 12 as long as Kiki's third-longest piece. (Note: The problem says third-longest piece, not third-longest length.)

How long is Raj's piece of string?

Enter your answer as a mixed numbe
Line plot titled Pieces of String. The number line is labeled Length in inches and goes from 4 and 1 fourth to 5 and 3 fourths by fourths. Thereare 2 marks above 4 and 1 fourth, 3 marks above 4 and 1 half, 2 marks above 4 and 3 fourths, 2 marks above 5, 4 marks above 5 and 1 fourth, 1 mark above 5 and 1 half, and 2 marks above 5 and 3 fourths.
Please no fake links, thanks!

Answers

Answer:19 inches

Step-by-step explanation:

19 inches have a good day

***no links please:)****

Answers

Answer:

A

Step-by-step explanation:

√64 = 8

so B isn’t correct because 8.16... is greater than 8 and the same is for C

The only correct option is A: 7.5

Answer:

the answer is

A because /64= 8

and between 6⅛ and 8

its 7½

Find the solution to the system of equations by graphing.

y= 6-x and y=x-2
A (2, 4)
B (-4,2)
C (4.2)
D no solutions

Help please!!

Answers

The answer is C

Do you need the step by step ?

Answer:

C is the answer :)

Step-by-step explanation:

I hope this answer helps you out!

6(5 - 3x) - 5(3x + 2)

Answers

Answer:

Step-by-step explanation:

I conclude that you need to find the value of x

6(5 - 3x) - 5(3x + 2)

30 - 18x -15x -10 = 0

-33x +20 = 0

33x = -20

x = -20/33

The answer is
= −33x+20

How many faces have an area of 70 cm2?

Answers

Answer:

3

Step-by-step explanation:

The base of it: 5*14 = 70

The left side: 14*5 = 70

The right side: 14*5 = 70

The two triangle sides are 7*12 = 84 cm^2

3 faces have an area of 70cm^2

which angle is adjacent to 9 ?

Answers

Adjacent means next to, so 12

Answer:

its the last one 12

Step-by-step explanation:

Other Questions
Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer PLZ HELP ASAP!!!!!!!!!!!!!! A store has two different coupons that customers can use. One coupon gives the customer $15 off their purchase, and the other coupon gives the customer 30% off of their purchase. Suppose they let a customer use both coupons and choose which coupon gets applied first. For this context, ignore sales tax.Let f be the function that inputs a cost (in dollars) and outputs the cost after applying the "$15 off" coupon, and let g be the function that inputs a cost (in dollars) and outputs the cost after applying the "35% off" coupon. a. Suppose acustomerwants to purchase asi 40 item and apply the si 5 of coupon first, and then the 35% or coupon How much will the item cost after applying the coupons?b. Suppose a customer wants to purchase a S 140 item and apply the SI 5 off coupon first, and then the 35% or coupon Ure ction notation to represent how much the item will cost (dollars) after applying the coupons. c. Suppose a customer wants to purchase a $140 item and apply the 35% om coupon first and then the sis of coupon How much will the item cost after applying the coupons?d. Suppose a customer wants to purchase a S 140 item and apply the "35% or coupon first and then the "S 15 off coupon. Usefu ction notation to represent how much the item will cost (dollars) after applying the coupons. Population, 1860-1920Year Percent Rural Percent Urban186080.219.8187074.325.7188071.828.2189064.935.1190060.439.6191054.445.6192048.851.2Which of the following statements is TRUE about the information displayed in thetable above?Between 1860 and 1880, rural population increased.Between 1860 and 1920, people began moving to cities.Between 1910 and 1920, rural and urban populations were even.D Between 1860 and 1920, urban and rural populations remained stable. A corporation declares a cash dividend on Friday, December 5th, payable to holders of record on Friday, December 19th. The local newspaper publishes the announcement on Monday, December 8th, while Standard and Poor's reports the dividend on Friday, December 12th. The ex date for regular way trades will be set at: A Friday, December 5th B Wednesday, December 17th C Thursday, December 18th D Friday, December 19th our situation is ____ to the problems the warehouse staff dealt with last year. analogous, opposite, incongruous, conducive, symmetrical Please help, show work! Limits and functions! 85 points! Answer for fee rbux and branlest!!!! i need answer NOW or i will be DIE (not good!!!) 61 1/20 as a decimal The length of a rectangle is six times its width.If the perimeter of the rectangle is 84 in, find its area.