Meiji leaders did all of the following except
a. instituted a constitutional monarchy
c. modernized the army and navy
b. introduced communism as the new social system
d. opened schools

Answers

Answer 1

Answer:

the answer is b

Explanation:

took the test made 100

Answer 2

Meiji leaders did all of the following except the introduction of communism as the new social system. Hence, option b is correct.

What was Meiji restorations?

The Meiji Restoration, also known as the Meiji Revolution,  Reform, or Renewal, was a political event that brought back effective imperial government to Japan in 1868 under Emperor Meiji. 

To end the era and strengthen Japan against the threat of colonization, the leaders of the Meiji Restoration, as this revolution came to be known, acted in the guise of restoring imperial control.

A tremendous growth in production and infrastructure was both made possible and necessary by Japan's quick industrialization and modernisation.

Japan established businesses including shipyards, iron smelters, and spinning mills, which were later sold to businessmen with connections. As a result, local businesses began utilizing Western technology to create goods that could be offered at a discount on the global market.

But introducing communism was not a subject for them. Hence, option b is correct here.

Find more on Meiji leaders :

https://brainly.com/question/18596698

#SPJ3


Related Questions

Which action is an example of the United States using economic influence as
a tool of foreign policy?

Answers

Answer:

it is probably D.

Explanation:

because for the example, it is creating an alliance with a country for the mutual protection.

explain mutual defense alliances and critique the role they played in starting World War I

Answers

Answer:

Mutual defense alliances was a significant cause for starting World War I. Basically, what happened was all of the countries were somehow alliances with other countries. Conflict between different countries caused the allied countries to be involved which eventually led to World War I.

what sport was among the first olympic events in 776 BC?

Answers

Answer:

Track and Field

Explanation:

What were the 2 major Kush accomplishments? Pick the 2 correct answers.​

Answers

Answer:

d

Explanation:

During the late 1800's and early 1900's millions of people immigrated to the United States. Identify and explain several reasons people left their homelands to move the United States.

Answers

In the late 1800s, people in many parts of the world decided to leave their homes and immigrate to the United States. Fleeing crop failure, land and job shortages, rising taxes, and famine, many came to the U. S. because it was perceived as the land of economic opportunity. Others came seeking personal freedom or relief from political and religious persecution, and nearly 12 million immigrants arrived in the United States between 1870 and 1900. During the 1870s and 1880s, the vast majority of these people were from Germany, Ireland, and England - the principal sources of immigration before the Civil War. Even so, a relatively large group of Chinese immigrated to the United States between the start of the California gold rush in 1849 and 1882, when federal law stopped their immigration.

Hope this help

In Islam, what provides a moral or ethical example for Muslims to follow?

Answers

Answer:

Islamic ethics (أخلاق إسلامية), defined as "good character," historically took shape gradually from the 7th century and was finally established by the 11th century.

Explanation:

Answer:

According to Islam, whatever leads to the welfare of the individual or society is morally good and whatever is injurious is morally bad. The ethical system prescribed in Islam is eternally divine and forms the foundation of an Islamic society.

Explanation:

google

Write a 2 short paragraph (10 complete sentences) that explains the central idea of the article. Use at least two details from the article to support your response.
PLZZZ HELP IF U HELP ILL GIVE U BRALIET AND EXPERT

Answers

Explanation:

Hi!!

refer attachments!!!

hope it helps!!!

what was the grand mosque of paris ​

Answers

Answer/Explanation:

The Grand Mosque of Paris is the 5th largest Muslim Shrine. It also is the oldest mosque in France making it high importance to French/Islamic culture.

In a_____________
one person of higher wealth, who has usually taken their power illegally, holds political
power

Answers

The answer is in a unity

Answer:

unity

Explanation:

one person of higher wealth, who has usually taken their power illegally, holds political

Which answer best details a weakness of the Articles of Confederation?

Answers

Answer:

Congress could not tax, regulate trade, or conduct foreign policy without the voluntary agreement of the states. They also could not raise a military force. These were all weaknesses of the Articles.

help please! you will get points.

Write about what your life would be like if you were a member of an ancient Chinese family.

Answers

My life would be very different if I lived in an ancient Chinese family.
For starters, I would be living with my parents, grandparents, aunts, uncles, and cousins, in one house! Even generations of family would all live under the same roof. If there were any boys/men in the house, they would continue to live with their family. This would mean that they would eventually take care of the people that helped take cared of them when they were younger. I would have probably been working on a small family farm. During the cold months, I would have worn a thick, padded jacket made of hemp. And in conclusion, family mattered most to the Chinese. Family would be the center of my life. I think, that I would have been happy with that if I was a member of an ancient Chinese family.

What could happen to soldiers that refused orders and were charged with Cowardice?

Answers

Answer:

They would be shot by a firing squad and if still alive the  officer in charge would finish the job with a revolver

Explanation:

Answer:

The soldier would be shot and if they were still alive the officer in charge would finish the job.

Explanation:

Who introduced the concept of scenery and wrote the ancient Greek play Antigone?

Plato
Sophocles
Herodotus
Oedipus

Answers

Answer:

b

Explanation:

Answer:

B

Explanation:

edge 2023 :)

PLSS HELP I WILL MARK BRAINLIEST
Why did Pericles pay people who held public office?

Answers

Answer:

Consider Athens before public officials were paid. The only people who would be willing to perform public service were the those who could afford to be away from their farms for many days, and sometimes weeks at a time. Ancient Greece (like most pre-industrial societies) was intensely agrarian, and the vast majority of farmers had few or no slaves. Therefore, public offices would consist overwhelmingly of the wealthiest Athenians. Instituting payment would allow a citizen to serve on the Boule or as a Magistrate without having to worry about how he would feed his family, and thus opened those positions to all Athenian citizens regardless of wealth (in theory).

Another of Pericles' reforms was to institute pay for those serving on juries (Note that juries in Athens were very large, often several hundred people). Aside from the aforementioned benefits, paying juries also served as something of a social safety-net. Those who were elderly or disabled, and thus incapable of working on the farm, could sign up their names, and then each morning they might be selected to serve on the jury for one of that day's trials. Juries were selected in this manner to counteract bribery--it would be very difficult to bribe such a large number of people on such short notice.

Explanation:

Answer:

Pericles paid the citizens because it allowed all people to participate in government

Explanation:

for person who asked

Answers

Answer:

thanks for points

:)

Explanation:

MARRY CHRISTMAS

Answer:

i asked

Explanation:

HELP ON TIMER!!!!

Someone with good moral character will likely __________.
A.
do the right thing, even if it is difficult
B.
do the right thing as long as it won't affect them negatively, like cause them to lose a friend
C.
do the right thing only when people in authority are watching them
D.
do the right thing only when it advantageous to do so


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

A because none of the other options are correct

Answer:

A

Explanation:

Legal judgments of good moral character can include consideration of honesty, trustworthiness, diligence, reliability, respect for the law, integrity, candor, discretion, observance of fiduciary duty, respect for the rights of others, absence of hatred and racism, fiscal responsibility, mental and emotional stability.

Correct me if im wrong :)

The first winner of the Kentucky Derby was:
Isaac Murphy
Oliver Lewis
Reginald Laury​

Answers

Answer:oliver lewis

Explanation:

Thomas Paine‘s common sense encouraged support for the American independence movement by

Answers

Answer:

The answer is A) appealing to the colonists sense of inalienable rights and liberty  

Explanation:

I believe it’s answer choice A .

3. The population of Virginia and Maryland was spread out on farms and
plantations near rivers because of what occupation?
1 point
a. Tobacco growing
b. Shipbuilding
c. Fishing
d. Fur trading

Answers

Answer:
A. Tobacco growing

Explain the structure of the government in ancient Athens. How did this system compare with the one used in the ancient city-state of Sparta?

Answers

Answer:

1A   One way that Athens and Sparta really differed was in their idea of getting along with the rest of the Greeks. Sparta seemed content to keep to itself and provide army and assistance when necessary. Athens, on the other hand, wanted to control more and more of the land around them. This eventually led to war between all the Greeks.

Explanation:

1B    Sparta was ruled by two kings, who ruled until they died or were forced out of office. Athens was ruled by archons, who were elected annually. Thus, because both parts of Athens' government had leaders who were elected, Athens is said to haveThe two rivals of ancient Greece that made the most noise and gave us the most traditions were Athens and Sparta. They were close together on a map, yet far apart in what they valued and how they lived their lives.

2  Athenian life was a creative wonderland. As an Athenian, you could get a good education and could pursue any of several kinds of arts or sciences. You could serve in the army or navy, but you didn't have to. (This applied only to boys, however: Girls were restricted to other pursuits, not war or business or education.

hope i helped

Answer:

1A   One way that Athens and Sparta really differed was in their idea of getting along with the rest of the Greeks. Sparta seemed content to keep to itself and provide army and assistance when necessary. Athens, on the other hand, wanted to control more and more of the land around them. This eventually led to war between all the Greeks.

1B    Sparta was ruled by two kings, who ruled until they died or were forced out of office. Athens was ruled by archons, who were elected annually. Thus, because both parts of Athens' government had leaders who were elected, Athens is said to haveThe two rivals of ancient Greece that made the most noise and gave us the most traditions were Athens and Sparta. They were close together on a map, yet far apart in what they valued and how they lived their lives.

2  Athenian life was a creative wonderland. As an Athenian, you could get a good education and could pursue any of several kinds of arts or sciences. You could serve in the army or navy, but you didn't have to. (This applied only to boys, however: Girls were restricted to other pursuits, not war or business or education.

Explanation:

Identify the causes and effects of the war of 1812

Answers

Causes:

Great Britain had violated American sovereignty by refusing to surrender western forts as promised in the Treaty of Paris after the Revolutionary War.

Effects:

Maritime Issues. Impressment was the most volatile issue between the United States and Britain.

The causes of the War of 1812 are: By refusing to surrender western forts as promised in the Treaty of Paris following the Revolutionary War, Britain had violated American sovereignty.

Its effects are: Maritime Issues. Impressment was the most volatile issue between the United States and Britain.

What was the War of 1812?

The United States of America and its indigenous allies fought the War of 1812 against the United Kingdom and its allies in British North America, with limited participation by Spain in Florida.

The War of 1812 altered the trajectory of American history. Because America had managed to bring the world's most powerful military power to a halt, it gained international respect. It also instilled a stronger sense of nationalism in its citizens. It inspired James Monroe and John Quincy Adams to write the Monroe Doctrine, the country's first statement of foreign policy.

Therefore, the causes and effects of the war of 1812 are identified above.

To learn more about War of 1812, click here:

https://brainly.com/question/13899658

#SPJ2

How did Martin Luther's actions begin the Protestant Reformation? Pope Leo X supported criticisms of the Catholic Church. Church leaders accepted the resignation of the Roman pope. Other leaders and thinkers split from the Catholic Church. German peasants revolted against high taxes and oppression.

Answers

The correct answer is C) Other leaders and thinkers split from the Catholic Church.

Martin Luther's actions began the Protestant Reformation when other leaders and thinkers split from the Catholic Church.

Martin Luther was a German priest that wrote the influential document titled "95 Theses," in 1517. In this document, he critiqued and disapproved the Catholic church practice of selling indulgences.  Martin Luther, who was also a faculty teacher at the University of Wittenberg.

Luther's ideas expressed in "95 Theses" caused havoc in the Catholic church. Other leaders and thinkers split from the Catholic Church and started Protestantism. This division hurt the power and presence of the pope and Catholicism all over Europe.

Answer:

C) Other leaders and thinkers split from the church

Explanation:

A is wrong because Pope Leo X excommunicated Martin Luther for his criticism, he didn't support him.

B is wrong because even though the church leaders accepted the resignation of the pope, that was a result of the Great Western Schism.

D is wrong because the German peasants started to revolt after ideas about the Protestant Reformation started to circulate around Europe.

This means C is correct.

please help me with this question :D

Answers

Answer:

A B

Explanation:

A map of Modern China. A key shows People per kilometer squared by color. Pink is 200 plus, purple is 100 to 200, green is 10 to 100, orange is 0 to 10. The Yellow River, Yangtze River, and Xi River are in the northeast of China. The Plateau of Tibet in Western China is orange. The North China Plain and regions surrounding the rivers are pink, purple, and green.
Study the two maps. Then, use the drop-down menus to answer the questions.

What part of ancient and modern China has a high population density?

How has the population of the Yangtze River valley changed over time?

What area is least populated, both in the present and in the past?

Answers

Answer:

The north china plain, it has increased, western china

Explanation:

got it right :)

Answer:

The north china plain, it has increased, western china

Explanation:

did it on edg.

What type of slave was most likely to gain freedom by reaching a maroon community? O A. Mothers travelling with children OB. A young maila travelling alone O C. Husbands travelling with wives OD. A young female travelling alone​

Answers

24 de cuadrado y triángulo jajajaja

HELP IM ON THE TEST RIGHT KNOW.
The Constitution allows each state to have as many electoral votes as it has
representatives in Congress. The size of the state's population is the basis for the number
of representatives. No state has fewer than three electoral votes. This is because each
state has two senators and at least one representative in the House of Representatives.

True
False

Answers

I think the answer is true

Produce a written guide to life in medieval Europe that analyzes the experiences and roles of the serf, merchant and artisan, noble, and ruling classes. Write one paragraph about each one.

Answers

Answer:

Roles of the serf, merchant and artisan, noble, and ruling classes are given below.

Explanation:

Serfs were the poorest people of the peasant class, and considered as a type of slave. Lords owned the serfs who lived on their lands and worked in the lands to grow crops for themselves and their lord in exchange for a place to live. Merchants are the people who sell and buy goods and trade in other countries. They brought goods from other countries and sell them in their own.  Artisan is a skilled craft worker who produces beautiful material objects partly or entirely by hand. noble refers to the religious people of the society who preaches their religion. Ruling classes refers to the people who controls or govern the society or country.

why would european powers want to de-skill their colonies?​

Answers

Answer:

They would want to do that so that they could have more people, even though not as skilled, working at jobs. This would make it easier for people who aren't as skilled at a certain topic to get a job.

Explanation:

De-skilling is when they bump down the requirements for a job. They would want to do this so that they could have more people at more jobs.

how did exploration change the world forever in a postive way? give two examples​

Answers

People discovers the America’s and many other islands

Help fastttttt plis plsi pls

Answers

Answer:

the firswt one

Explanation:

Answer:

the first one?

Explanation:

i need to read the passage lel

Other Questions
Which of these sentences is the best definition of "verb tense"?where things happenwhy things happenwhat happens to a characterwhen things happen what is 5 1/3 as an improper fraction?? Solve for x.And please show me how u got the answer 9124x - 2)3x + 2 Comparing FunctionsHow much money will Bob in December have if his bank account growth stays at the same rate?Month Bank-Acc |January | $5,000February $6,700March $8,400April $10,100May $11,800 Which country closed its ports to farmers?A. SpainB. FranceC. England Can you help me plz? Write an equation in point-slope form for the line through the given point with the given slope(8,-3);m= -1/4 a drum has a diameter of 18 in and is 16 in deep find the volume What is the special rule with multiplying or dividing an equality by a negative number? (Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town?