need help today!!!! plzs

Need Help Today!!!! Plzs

Answers

Answer 1

Answer:

x=29

Step-by-step explanation:

cuz it's a 90 degree angle so 90-32 is 58 and divide it by 2 is 29 which would be x=29


Related Questions

Need help (100 easy points)

Answers

Answer:

Step-by-step explanation:

I think of a number, double it, then subtract 7. The result is 10.
Find the number.

Answers

Answer:

17/2

Step-by-step explanation:

Work backwards. you have 10, then opposite of subtract 7 is add 7 which gives you 17. then opposite of double is half getting you 8.5 or 17/2

Answer:

Your number is 8.5 or 17/2

Step-by-step explanation:

Let's say your number is equal to the variable n.

Then we can set up an equation for this scenario: 2n - 7 = 10

Now, we need to use algebra to solve:

2n - 7 = 10 → add 7 to both sides

2n = 17 → divide both sides by 2

n = 17/2 = 8.5

Thus, the number you were thinking of was 8.5, or 17/2

Fill in the blanks to complete the proofs

Answers

Answer:

Look at the image I attached to my response.

Step-by-step explanation:

For proof #3, I did it according to the way I was taught how to do proofs in my state/school, so what you wrote could be correct.

Alexa is trying to pick out an outfit for the first day of school. She can choose from 8 pairs of pants, 6 t-shirts, 6 sweaters or hoodies, and 2 pairs of shoes. How many different outfits does Alexa have to choose from?

Answers

The number of different outfits is 576

How to determine the number of different outfits?

From the question, we have the following parameters that can be used in our computation:

8 pairs of pants, 6 t-shirts, 6 sweaters or hoodies, and 2 pairs of shoes

The number of different outfits is the products of the count of each apparel

This is represented as

Different outfits = Pants * T-shirts * Sweaters or hoodies * Pairs of shoes

Substitute the known values in the above equation

Different outfits = 8 * 6 * 6 * 2

Evaluate

Different outfits = 576

Hence, there are 576 different outfits

Read more about combination at

brainly.com/question/11732255

#SPJ1

a number m is either less than 2 or greater than 9

Answers

it would be a big mistake to have a number like that

The population of a city has decreased by 35% since it was last measured. If the current population is 20,800, what was the previous population?


help pls

Answers

The previous population of the city was 32,000.

What is percentage?

Percentage is a measurement to find value of given number out of hundred.

Given that,

The current population of the city = 20,800.

Let the previous population was 100%.

Since, The population of the city decreased by 35%,

So, the current population of the city = 100 - 35 = 65%

According to given condition,

65 % = 20800

1 % = 20800 / 65

1 % = 320

100% = 320 x 100

         = 32,000

Hence, the initial population was 32,000.

To learn more on Percentage on:

https://brainly.com/question/24120406

#SPJ1

What is the value of the following expression 20 19 − 5 7?

Answers

The value of the expression after simplification is found as 415.

What is meant by the term simplification?

To simplify simple means to make anything easier. In mathematics, simplifying an equation, fraction, or problem means taking it and making it simpler.

Calculations and problem-solving techniques simplify the issue.

We can —

By eliminating all common elements from the numerator and denominator and putting the fraction through its simplest/lowest form, fractions can be made simpler.By combining and grouping like terms, mathematical expressions can be made simpler. This makes the phrase simple to comprehend and to solve.

The given expression is-

= 20 x 19 + 5 x 7

Applying the BODMAS, multiply the numbers.

= 380 + 35

Add the values,

= 415

Thus, the value of the expression after simplification is found as 415.

To know more about the simplification, here

https://brainly.com/question/723406

#SPJ4

The correct question is-

What is the value of the following expression 20 x 19 + 5 x 7?

Which system of equations can be used to find the roots of the equation 4x 5 12x?

Answers

The system of equations that can be used to find the roots of the equation 4x 5 12x is:x = -5/8

1. Set up the equation: 4x - 12x = 5

2. Simplify the equation on the left side: -8x = 5

3. Solve for x: x = -5/8

To find the roots of the equation 4x - 12x = 5, we must first set up the equation. On the left side of the equation, we can simplify it to -8x = 5. Then, we can solve for x by dividing both sides by -8, giving us x = -5/8. This is the solution to the system of equations, and the root of the original equation.

Learn more about equation here

https://brainly.com/question/29657992

#SPJ4

Is there a calculator that solves algebra?

Answers

Answer:

yes

Step-by-step explanation:

do you want names for online ones

Which of the following is equal to (x^4 + 4x^3 − 3x^2 − 12x) divided by (x + 4)?
F x^3 − 3x G x3 + 3x
H x^3 − 2x^2 − 3x
G x^3 + 3x
J x^3 + 2x^2 − 3x

Answers

Answer:

F

Step-by-step explanation:

[tex]x^4+4x^3-3x^2-12x=x^3(x+4)-3x(x+4)=(x^3-3x)(x+4) \\ \\ \therefore \frac{x^4+4x^3-3x^2-12x}{x+4}=x^3-3x[/tex]

A covered Bridge is 8 yards long. In a photograph for sale at a gallery The Bridge is 5/12 foot-long which statements are true?

1. One yard of the covered Bridge is represented by 1.6 inches in the photograph
2. One inch on the photograph represents 1.6 yards of the real bridge.
3. A tree that is 3 inches tall in the photograph is 4.8 yards tall.
4. The people walking over the bridge are about 2.5 inches tall in the photograph.
5. A river that is 12 yards wide is 7.5 inches wide in the photograph.
(PLEASE EXPLAIN)

Answers

Answer:

2. One inch on the photograph represents 1.6 yards of the real bridge.

Step-by-step explanation:

1 yd = 36 in.

8 yd = 36 in./yd × 8 yd = 288 in

1 ft = 12 in.

5/12 ft × 12 in./ft = 5 in.

5 in. in the picture equals 288 inches real.

1 in. in the picture equals 57.6 inches real.

57.6 in. × (1 yd)/(36 in.) = 1.6 yd

1 in. in the picture equals 1.6 yd real

Answer:

2. One inch on the photograph represents 1.6 yards of the real bridge.

Find the product:
[2 1 0] x [1 -1 2] = [a b c]
[-1 -2 1]
[0 1 1]

Answers

Step-by-step explanation:

the multiplication result is found by row×column multiplications.

1st row × 1st column = a

2×1 + 1×-1 + 0×0 = 2 - 1 = 1 = a

1st row × 2nd column = b

2×-1 + 1×-2 + 0×1 = -2 + -2 = -4 = b

1st row × 3rd column = c

2×2 + 1×1 + 0×1 = 4 + 1 = 5 = c

What is the median of the sample 5 5 11 9 8 5 8?

Answers

The median for the next batch of observations is 8.

What is median?

The median is the value in the middle of a data set, which indicates that 50% of the data points have a value less than or equal to the median, and 50% have a value greater than or equal to the median. The median is the number in the middle of a set of numbers. The median represents the 50th percentile of the set of numbers. In other words, the median is the value in the center of a set of numbers where half are less than the median and half are more than the median.

Here,

given set of observation,

= 5,5,5,8,8,9,11

n=7

median=(7+1)/2

=4th term

=8

The median for following set of observation is 8.

To know more about median,

brainly.com/question/29156884

#SPJ4

Find (x^4 − 5x^3 + 17x + 3) divided
by (x − 3).

Answers

Answer:

the division of (x^4 − 5x^3 + 17x + 3) by (x − 3) is equal to x^3 - 3x^2 + 4x - 3, with a remainder of 0.

Step-by-step explanation:

To divide (x^4 − 5x^3 + 17x + 3) by (x − 3), we can use polynomial long division. This involves dividing the polynomial by the divisor (x - 3) and expressing the result as a quotient plus a remainder. The remainder will be a polynomial of degree less than the degree of the divisor.

Here is how the division would look:

x  -3      x^4   -5x^3   17x   3

--- -----   ----  -----   ---  ---

 x  -3      x^3   -5x^2   17    0

           x^3  -3x^2   -2x^2   3

            0    -2x^2  -2x^2   0

            0      0     -4x^2   3

            0      0       -4x^2 -9

            0      0         0   -9

            0      0         0    0

From this division, we can see that the quotient is x^3 - 3x^2 + 4x - 3, and the remainder is 0. Therefore, we can express the division as:

(x^4 − 5x^3 + 17x + 3) / (x − 3) = (x^3 - 3x^2 + 4x - 3) + 0

This means that the division of (x^4 − 5x^3 + 17x + 3) by (x − 3) is equal to x^3 - 3x^2 + 4x - 3, with a remainder of 0.

Given equation= (x^4 - 5 x^3 + 17 x + 3)/(x - 3)

alternate form-x^3 - 2 x^2 - 6 x - 1 (for x!=3)

expanded form-x ((x - 2) x - 6) - 1 (for x!=3)

x^4/(x - 3) - (5 x^3)/(x - 3) + (17 x)/(x - 3) + 3/(x - 3)

quotient form and reminder-x^4 - 5 x^3 + 17 x + 3 = (x^3 - 2 x^2 - 6 x - 1)(x - 3) + 0.

For more equation questions see,

https://brainly.com/question/27893282

jksjsisks 78i2o
[tex]32. \frac{33}{31?} [/tex]

Answers

Answer:

34.064516129

Step-by-step explanation:

[tex]32 \times \frac{33}{31} = \frac{1056}{31} [/tex]

[tex] = 34.064516129[/tex]

i hope this helps

Benjamin bought two pounds of strawberries for 12.80. What is the price, in dollars per ounce of strawberries?

Answers

Answer: 6.4

Step-by-step explanation:

divide in half

N
A city has a population of 360,000 people. Suppose that each year the population grows by 3%. What will the population be after 13 years?
Use the calculator provided and round your answer to the nearest whole number.

Answers

Answer:

528,672

Step-by-step explanation:

A=P(1+r)^t

360,000(1+.03)^13 = 528,672.1368

Rounded: 528,672

What is the solution to the system of equations?
x-y+2z=9
3x+y=z=2
2x-y+z=8

Answers

Answer:

x=8/7, y=-25/7, z=15/7

Step-by-step explanation:

x-y+2z=9 ==> equation 1

3x+y=z=2 ==> equation 2

2x-y+z=8 ==> equation 3

  3x+y+z=2

+ (2x-y+z=8)

3x+2x + y+(-y)  + z+z = 2+8  ==> add equation 2 and 3 to eliminate y

 5x + 2z = 10  ==> equation 4

  x-y+2z=9

- (2x-y+z=8)

x - 2x + (-y)-(-y) + 2z-z = 9-8 ==> subtract equation 1 and 3 to eliminate y

-x + 0 + z = 1  ==> Let's say -y=a. (-y)-(-y) = a-a = 0.

(-x + z = 1)*2 ==> multiply by 2 to get z to become 2z

-2x + 2z = 2  ==> equation 5

   5x + 2z = 10

- (-2x + 2z = 2)

5x-(-2x) + 2z-2z = 10-2 ==> subtract equation 4 and 5 to solve for x

5x+2x = 8

7x = 8  ==> divide both sides by 7 to isolate x

x = 8/7

-2(8/7) + 2z = 2  ==> plugin x into equation 5 to solve for z

-16/7 + 2z = 2 ==> simplify

(-16/7 + 2z = 2)*7  ==> multiply the equation by 7 to eliminate fractions

-16 + 14z = 14

14z = 30  ==> add 16 on both sides to isolate z

z = 30/14  ==> divide each side by 14

z = 15/7  ==> simplify

2(8/7)-y+(15/7)=8  ==> plugin x = 8/7 and z = 15/7 into equation 3

16/7 - y + 15/7 = 8

(16/7 + 15/7 - y = 8)*7  ==> multiply the equation by 7 to remove fractions

16 + 15 - 7y = 56

31 - 7y = 56

-7y = 25  ==> subtract 31 on both sides to isolate y

7y = -25

y = -25/7

Answer: (x=8/7, y=15/7, z=-25/7)

Where is the domain and range of a function?

Answers

On solving the provided question we can say that - The range of f(x) is a subset of this range, which is the range of -3x-2  (-14,∞)

What is Domain?

The range of values that may be plugged into a function is known as its domain. In a function like f, this set represents the x values (x). The collection of values that a function can take on is known as its range. The values that the function outputs when we enter an x value are in this set. Let y = f(x) be a function where x and y are the independent and dependent variables. If a function f offers a means of successfully generating a single value y while employing a value for x to that end, then the selected x-value is said to belong to the domain of f.

f(x)=  -3x-2     x <4

       3/4x-1   x [tex]\geq[/tex] 4

Domain =

The range of f(x) is a subset of this range, which is the range of -3x-2  (-14,∞).

To know more about Domain visit:
https://brainly.com/question/28135761

#SPJ4

A box is dragged without acceleration in a straight-line path across a level surface by a force of 100 n. What is the frictional force between the box and the surface?.

Answers

The frictional force between the box and the surface is 100 newtons .

Since the body being dragged across the surface is not accelerating, the acceleration of the body is 0m/s².

From Newtons second law of motion, F = ma where;

F is the sum of the forces acting on the body

m is the mass of the body

a is the acceleration

If the box is dragged along a straight line by a force of 100 N, its moving force (Fm) is 100 N and the frictional force (Ff) will act opposite to this force.

Resultant force acting on the box along the horizontal will be Fm+(-Ff)

Therefore;

Fm+(-Ff) = ma

Fm-Ff = ma

Since a = 0m/s²

Fm-Ff = m(0)

Fm-Ff = 0

Fm = Ff

This shows that for a static body, the moving force acting on the body will be the same as the frictional force. Since Fm = 100 N

Frictional force (Ff) = 100 N

Therefore, the frictional force between the box and the surface is 100 N

Learn more about the straight line here:

https://brainly.com/question/29223887

#SPJ4

How do you find the duplicate number on a given integer array in Python?

Answers

The duplicate number on a given integer array in Python can be found  through two loops.

How do you find the duplicate number on a given integer array in Python?

We need to print the duplicate elements present in the array. This can be done through two loops. The first loop will select an element and the second loop will iteration through the array by comparing the selected element with other elements. If a match is found, print the duplicate element.

ALGORITHM:

STEP 1: Declare and initialize an array.

STEP 2: Duplicate elements can be found using two loops. The outer       loop will iterate through the array from 0 to length of the array. The outer loop will select an element. The inner loop will be used to compare the selected element with the rest of the elements of the array.

STEP 3: If a match is found which means the duplicate element is found then, display the element.

PYTHON PROGRAM:

#Initialize array    

arr = [ ];    

print("Duplicate elements in given array: ");    

#Searches for duplicate element    

for i in range(0, len(arr)):    

   for j in range(i+1, len(arr)):    

       if(arr[i] == arr[j]):    

           print(arr[j]);  

The duplicate number on a given integer array in Python can be found  through two loops.

To know more about duplicate number on integer array , check out:

https://brainly.com/question/14598156

#SPJ4

lins family had completed 60% of a trip. they have traveled 30 miles. how many miles is the trip

Answers

Lin's family make a trip of length 50 miles.

What is a trip?

People move between far-off geographic regions when they travel. Travel can be done with or without luggage, on foot, by bicycle, car, rail, boat, airline, ship, or by another mode of transportation. It can also be one way or round trip.

Given that Lin's family had completed 60% of a trip.

Thus they have to travel (100 - 60)% = 40% of the trip.

Also given that, they have traveled 30 miles..

Therefore,

60% of the trip is equal to 30 miles.

1% of  the trip is equal to 30/60% miles.

100%  the trip is equal to (30× 100%)/60% miles.

                                         = 50 miles.

To learn more about percentage, click on below link:

https://brainly.com/question/13914975

#SPJ1

the equation of a line is y equals 4 over 3 x minus 5 over 3. what would be the slope of a line perpendicular to this line?

Answers

The slope of the line perpendicular to the given line is calculated by taking the negative reciprocal of the given slope.The slope of the given line is 4/3. The slope of the line perpendicular to the given line is -3/4.

To find the slope of a line perpendicular to the given line, we need to take the negative reciprocal of the slope of the given line. The equation of the given line is y = 4/3x - 5/3. To calculate the slope, we need to rearrange the equation to the form y = mx + b, where m is the slope and b is the y-intercept. Rearranging the equation to the form y = mx + b, we get y = 4/3x - 5/3 which can be written as 4/3x - y = 5/3. The slope of the given line is 4/3. To find the slope of the line perpendicular to the given line, we take the negative reciprocal of 4/3 which is -3/4. Therefore, the slope of the line perpendicular to the given line is -3/4.

y = 4/3x - 5/3

4/3x - y = 5/3.

Learn more about slope here

https://brainly.com/question/3605446

#SPJ4

if I bought a $40 basket and it was on sale for 50% off but added 10% sales tax how much is it

Answers

Answer:

$24

Step-by-step explanation:

50% of 40 = 20

10% of 40 = 4

20+4=$24

megan wants to test her assumption on the amount of sleep students are getting. she decides to focus her efforts on examining if students are getting less than eight hours of sleep. what should megan state for the null hypothesis and alternative hypothesis?

Answers

Your research question can also be answered by the alternative hypothesis (Ha). The populace, according to the assertion, is affected.

What is an alternative hypothesis?Your alternate theory and research hypothesis are frequently same. It is the assertion that you anticipate or hope will be accurate, to put it another way.The complementary idea to the null hypothesis is the alternative theory. The extensive nature of the null and alternative hypotheses ensures that they account for every scenario. As only one of them may be true at once, they are also mutually exclusive.When writing a research paper or thesis, use caution when describing the findings of a statistical test. When the null hypothesis is rejected, the alternative hypothesis is said to be supported. Conversely, if you are unable to disprove the null hypothesis, you can conclude that the alternative hypothesis is unsupported. Never assert that a theory has been supported or refuted.Alternative hypotheses frequently make use of words like "an effect," "a difference," or "a relationship." A mathematical inequality (often, but occasionally or >) is always included in alternative hypotheses. The formulation of an alternative hypothesis can be expressed in a variety of ways, just like null hypotheses.

To Learn more About alternative hypothesis refer to:

https://brainly.com/question/25263462

#SPJ1

Is physics science hard?

Answers

Yes, it is hard but with a lot of practice and putting effort one can also find it easy.

Why physics is hard?

Physics requires the ability to solve problems, which can only be acquired via practice. In addition to these difficult ideas, there are theoretical concepts, mathematical calculations, and laboratory experiments.

How to deal with physics?

It is better to comprehend the derivations than to memorise the formulas. Making a mess of several formulas will just increase your anxiety over the topic. Instead, if you strive to comprehend where they originate, you will begin to appreciate physics and its applications.

Physics is a difficult topic since it combines science and arithmetic, which may be challenging for the best of us. Nevertheless, despite how difficult it is, you can achieve if you follow a few simple guidelines and put yourself through some practice.

To learn more about physics visit the link:

https://brainly.com/question/28012687

#SPJ4

5 ≤ y + 2 ≤ 11 find the compound inequality

Answers

Answer:jkd

Step-by-step explanation:

d

pls help me due asap

Answers

Answer:

iam think that y=2x cause curve y have two curve x

find the limit of the points specified

Please someone help me with this!
A projectile is fired from the ground at an angle of 30 degrees above the horizon with an initial velocity of 960 ft/sec. If the height as a function of time t is given by h(t)=480t-16t^2, find,
The time when the projectile hits the ground
The maximum height

Answers

I think

h(t)=480t–16t^2

Max height is the vertex of the parabola at t = -b/2a

t = -480/-32 = 15 seconds

--> h(15)

What is the relationship between a scalene triangle and
the location of its centroid? Explain.
O A. The centroid will always be inside the scalene
triangle, since the centroid is always inside
any type of triangle.
O
O
O
B. The centroid will always be outside the
scalene triangle, since the centroid is always
outside any type of triangle.
C.
The centroid will always be on the scalene
triangle, since the centroid is always on a
triangle with no congruent side lengths.
D.
The centroid will be inside, on, or outside the
scalene triangle, depending on whether it is
acute, right, or obtuse, respectively. The
number of congruent sides does not affect
the location of the centroid.

Answers

The relationship between a scalene triangle and the location of its centroid is; A: The centroid will always be inside the scalene

triangle, since the centroid is always inside any type of triangle.

What is the location of the centroid of the triangle?

A scalene triangle is a triangle in which all three sides have different lengths. Also the angles of a scalene triangle have different measures.

Some right triangles can be a scalene triangle when the other two angles or the legs are not congruent.

Now, a centroid of a triangle is defined as the point formed by the intersection of the medians of the triangle. Now, the medians of a triangle always lie within a triangle. This means that their intersection point which is the centroid of a triangle always lies inside a triangle.

Thus, the centroid of the scalene triangle can be concluded to always lie inside the triangle.

Read more about centroid of triangle at; https://brainly.com/question/7644338

#SPJ1

Other Questions
Which describes the translation of ABCD to A'B'C'D'.A)translation 3 units right and 6 units uptranslation 6 units right and 3 units uptranslation 3 units left and 6 units downD)translation 6 units left and 3 units down What is another vocabulary word for slope? I need help ASAP!!A.DB.BC.CD.A ms. lorenz needs to rent a car for 3 days. she can choose from two plans. plan a costs $60 per day. plan b costs $30 per day plus $.40 for each mile she drives. ms lorenz decides that plan b will cost her less than plan a. write and solve an inequality to represent the number of miles, m, that ms. lorenz expects to drive. PLEASE HELP!!! Pools are not selling well at Jays Store. So, he decides to put them on clearance for $19.99, plus an extra 20% off. Approximately how much will the small pool cost? Give me a brief summary of the middle age era of music? Find the mussing numbers13315+ ****24 305 Matt decides the length of his table will be 15 in. He calculates that the area of the table is 30 in. squared. Determine if Matts calculation is correct what do ducks short necks help them to do? pls help :/ A piece of fabric 4 meters long is cut into two pieces. One piece is 1.25 meters long. How much longer is the second piece of fabric? How do religious and ethnic groups both reflect and influence the geography of places at differentscales? You must use a number line!n + 5 > 13PLZ HELP ILL PUT BRAINLIEST What is the measure of arc QSR? Use the drop-down menus to complete these sentences.The running of a set of programming instructions multiple times is called .If a sequence of code is repeated multiple times, it is referred to as .One set of coding instructions processing many different sets of data and eliminating multiple lines of code is an example of An item on sale costs %50 of the original price. The original price was 45$.Find the sale price.Please help! I will give the brainiest! 9.5/19=x/30 solve the proportion Where are Gold, Limestone and kaiolin found. PLEASE HELP NO LINKS IM TIMED 1/2 x 1 3/5 to the simplest form Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG Match the words in the left column to the appropriate blanks in the sentences on the right. The secondary structure given in the MaxExpect results can best be described as_________ Thus, the type of RNA is best classified as_________ a single strand with a distinctive cloverleaf structure a single-stranded random coll an unspecified type of RNA rRNA a single strand folded upon itself to form a small, round structure tRNA