*please be serious *
How does digestion and transport interact to keep and organism alive ?

Answers

Answer 1

Answer:

Explanation:

Digestion breaks down the food or nutrients taken in by the organism into a form of energy that is then transported to areas of the organism where it is needed. Along with transporting the waste to exit the organsim because the waste is no longer needed as digestion has extracted its nutrients.


Related Questions

Susan is investigating physical changes. To do this, she places some ice into a large bowl and seals it with a lid. She leaves the bowl on the counter for several hours until all of the ice has melted. Using a balance, Susan determines that the mass of both the water and the ice are equal. Why is the mass of the ice and the water the same? (SC.8.P.9.1)

Answers

Answer:

No mass loss

Explanation:

The mass of ice and the water in the different state are equal because the same of quantity of matter is present in both state of matter of matter.

In essence, the mass of the physical change process is conserved. When mass is conserved, matter is neither created nor destroyed but can be changed from one form to the other. This is in compliance with the law of conservation of matter. So, no mass was lost in the physical change process and the mass will remain the same.

Which of the following samples of water will contain the most heat?

А-1 KL of water at 20°C
B- 1 kL of water at 70°C
C- 1 mL of water at 50°C
D- 1 mL of water at 80°C

Answers

Answer:

The answer is D- make sure you give good rate

What does the salinity of sea water represent?
the concentration of salt dissolved in the ocean
A.the concentration of all

B. dissolved chemicals in the ocean

C. the volume of salt in the ocean

D.the mass of salt in the ocean

PLEASE GIVE ME THE RIGHT ANSWER!

Answers

Answer:

the answer is b

Explanation:

DRAW A PEDIGREE

Read the following information and ON NOTEBOOK PAPER, construct a pedigree using the symbols we went over Tuesday: Scott is married to Christa. They have 3 children, Blake (a son), Peyton (a daughter), and Ashton (a daughter). Blake is married to Allie and they have 2 children, Henry (a son) and Harper (a daughter).

When you have completed your pedigree drawing, take a picture and attach it to this assignment and submit.

Answers

Answer:

Here you go

Explanation:

how to find the electron in an atom/element

Answers

Answer:

to find the number of electrons an element has locate it on the periodic table of elements find the atomic number and note the number of protons because they are naturally electrically neutral

Answer:

M-A=N

Explanation:

M-A=N

Here is an example.

The equation above means that the atomic number (A) subtracted from the average atomic mass (M) equals the combined amount of neutrons and protons. Since we know that 35 17Cl is Chlorine (this is because Chlorine (Cl) is the 17th number on the periodic table and has the average atomic mass of 35), we can insert our data into the equation and end up with the following:

35-17=18.

From here, we can tell that we have a mix of neutrons and protons, with the total being 18. Since the atomic number is 17, we can reasonably assume that there are 17 protons and 1 neutron.

But we still need to find the number of electrons. Fortunately, the number of electrons is always equivilant to the number of protons and the atomic mass, so we know that the number of electrons is 17.

So, we have;

17 Protons

1 Neutron

17 Electrons

What is a mixture of sugar and water?

a solution

molecule

a compound

a precipitate

Answers

Explanation:

I think its a solution just me tell me in comments if right

Answer:

A solution

Explanation:

Sugar is soluble in water and would dissolve into the water to form a solution.

help with this question

Answers

Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

Zinc metal (Zn) reacts with hydrochloric acid (HCI) to produce hydrogen gas (H) and zinc chloride (ZnCl2). A scientist has powdered zinc and a chunk of zinc of equal mass. Available in the lab are dilute HCl and concentrated HCl. Which combination of zinc and acid would react most quickly? Explain why the combination you chose would make the reaction occur most quickly.​

Answers

Answer:

hello I am interested in the position and would like to know if you have any questions please feel free to contact me at any time if

Are the atoms really "sharing" electrons

Answers

No they are donating them

Which is the correct Lewis dot structure for BeH2 ?

Answers

H• •Be• •H --> H:Be:H
Since there are 4 valence electrons in total, Beryllium has 2 and Hydrogen has 2. You would put the Be in the middle because there is only 1 of them.

The correct Lewis dot structure for [tex]BeH_2[/tex] is Be : H : H

What does the  Lewis dot structure show?

The Lewis dot structure shows the valence electrons as dots. The valence electrons of beryllium are shown as 2 dots on the left side of the atom.

The central atom, beryllium, has 2 valence electrons where each hydrogen atom has 1 valence electron. To form a stable molecule, beryllium shares its 2 valence electrons with the 2 hydrogen atoms, each of which shares its 1 valence electron with beryllium which gives each atom a full outer shell of electrons.

Learn more about Lewis dot structure at:

https://brainly.com/question/28652824

#SPJ6

ayo, have some points

Answers

Answer:

aha thank you :)

Explanation:

Answer:

thank you :)

Explanation:

How many grams are in 7.5 moles of C6H12?



Group of answer choices

0.09g

630g

11.2

84g

Answers

Answer:

630gC₆H₁₂

Explanation:

How many grams are in 7.5 moles of C₆H₁₂?

C₆:12.011×6=72.066

H₁₂:1.008×12=12.096

72.066+12.096=84.162

84.162g/mol C₆H₁₂

7.5 molC₆H₁₂ ×84.162g/molC₆H₁₂= 631.215gC₆H₁₂

Explain why the electron configuration of 2-3-1 represents an atom in an excited state?

Answers

Answer:

See explanation

Explanation:

If we look at the electron configuration closely, we will discover that the element must have had a ground state electron configuration of 2,4.

This is because, the innermost shell usually holds two electrons while the outer shells hold eight electrons each. The four electrons must be accommodated in the second shell in the ground state configuration of the compound.

However, when the atom is excited, one electron from this shell may move to the third shell to give the excited state configuration 2-3-1 as shown in the question.

How can magnetic force be exerted on objects?

1)Over a distance and anytime an object is in a magnet's field of influence.

2)Only through objects.

3)Only by touching an object.

Answers

I think the answer is : 1

A group of tourists were on an outing when they noticed that precipitation began to fall. The air temperature was 32 degree Fahrenheit. What type of precipitation did they most likely see?

Answers

Answer:

The correct answer is - rain.

Explanation:

At 32 degrees c or zero degrees Celsius, droplets of water in the atmosphere do not freeze as it is not the temperature at which water freezes but it is the temperature at which ice melts.

At this temperature the water changes its state, below 32 degrees Fahrenheit the water freezes but in the atmosphere, it not freezes necessarily and remains in the liquid state and called super-cooled liquid or water. Above this temperature, water in liquid state.

Thus, the precipitation is in the form of rain.

21 III
Choose the geologic formation that fits the description: rocks are stretched, moved
vertically into blocks, and dropped; the lower blocks are called graben and the taller
blocks called horst.
O volcanic mountains
O ocean ridges
O fault block mountains
folded mountains

Answers

Fault block mountains folded mountains

Answer:

Lifted fault block mountains

Explanation:

why is a rise in sea level significant?

Answers

Answer:

I honestly dont know but its cool problably from water fill or from the waves going to much

Explanation:

the answer I can think of is it might be the way the water has waves and it moves a lot

How much oxygen (O) is in 5.41 × 106 atoms of oxygen

Answers

Answer:

They show you  how to do it sweetie

Explanation:

123456789 Common math

If you start with 14.0 grams of diatomic nitrogen (N2) how many grams of diatomic hydrogen (H2) will react with it?

Answers

Answer:

I just need points

Explanation:

whegehhwjwjwhehebebejeuhebehejejbebe

You have discovered an element that is a poor conductor of electricity, has a low melting point, and is a gas at room temperature. How would you classify this element?


A.metal

B.metalloid

C.actinoid

D.nonmetal

Answers

AHHH ITS B SORRY I ACTUALLY KNOE THIS

The chemical equation describing the burning of hydrogen gas is: 2H2 + O2 ---> 2H2O.
Why is this both a synthesis and a combustion reaction?

Answers

Answer:

"A combustion reaction is a reaction in which a substance reacts with oxygen gas, releasing energy in the form of light and heat. Combustion reactions must involve O2 as one reactant. The combustion of hydrogen gas produces water vapor." and "A synthesis reaction occurs when two or more reactants combine to form a single product. ... In a double replacement reaction, two compounds exchange elements. A combustion reaction occurs when a substance reacts quickly with oxygen. Combustion is commonly called burning"

Explanation:

I tried

the force that holds paticles together in the atomic nuecleaus?

Answers

Explanation:

i believe you meant particles*

Given a balanced chemical equation it is always possible to determine
A)
the physical state of the products and reactants
B)
whether a reaction will or will not take place
C)
the relative number of moles taking part in the reaction
D)
the conditions necessary for the reaction to take place

Answers

Answer:

C)  the relative number of moles taking part in the reaction

Explanation:

From a balanced chemical equation, it is always possible to determine the relative number of moles taking part in a chemical reaction.

The number of moles is the amount of the reacting specie that makes up a chemical reaction.

In balanced chemical equation, the number of moles of reactants and products must be the same. From this understanding, we can determine the amount of reactants and products needed for a chemical reaction to take place.

A nitrogen molecule (N2) has one triple bond. How many electrons do the nitrogen atoms share?

A. 1
B. 3
C. 4
D. 6

Answers

Answer:

3 electrons

Explanation:

HELPPPPPPPPPPPPPPPPPPP

Answers

Answer:

not sure about the first one, but i know SDS provides information about the last 3.

Explanation:

WILL GIVE BRAINLIEST (major help!!! need now!!!) David observed properties of four different compounds, only one of which is an ionic compound. His observations are shown in the chart.
A 2-column table with 4 rows. The first column labeled compound has entries W, X, Y, Z. The second column labeled observations has entries is a hard solid, melts at 44 degrees C, has a molecular structure; is a brittle solid, does not conduct electricity in water, has a crystal structure; is a hard solid, conducts electricity, has a molecular structure; is a brittle solid, melts at 801 degrees C, has a crystal structure.

Which is most likely the ionic compound?


W

X

Y

Z

Answers

Answer:I think it’s y sorry if I’m wrong

Explanation:

Answer:

i think it might be y

Explanation:

If you have 2.0 moles of sodium chloride (NaCl), what is its mass in grams?

Answers

Answer:

117g

Explanation:

Given parameters:

Number of moles = 2moles

Unknown:

Mass of NaCl  = ?

Solution:

To solve the problem, we need to use the expression below;

    Mass of NaCl  = number of moles x molar mass

Molar mass of NaCl  = 23 + 35.5  = 58.5g/mol

 

So;

Insert the parameters and solve;

     Mass of NaCl  = 2 x 58.5  = 117g

How many molecules are equal to 3.25 moles of carbon dioxide?

Answers

Answer:

1.957 × 10²⁴ molecules

Explanation:

The number of carbon dioxide molecules can be found by using the formula

N = n × L

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

From the question we have

N = 3.25 × 6.02 × 10²³

We have the final answer as

1.957 × 10²⁴ molecules

Hope this helps you

5. Which of the following elements will have a charge of 4+ or 4- as an ion?

Answers

Answer:

The answer would either be Carbon or Silicon.

Explanation:

Help me please:(:(:( with my bellwork
for brainiest

Answers

Answer:

Elements are made of only one kind of atom

Compounds are made of 2 or more elements chemically bonded together

Explanation:

Its right there????

Other Questions
Please help me this is due less then 30 mins. If you are good with Spanish please help me and look at the picture and use usted and ellos and also the second picture looks like the lady packing a suitcase. Movement of individuals into or out of the population, called gene flow, impacts evolution of populations because:_________. a. it can lead to extinction of one or more populations. b. it may cause genetic drift. c. it leads to a redistribution of alleles d. adaptive radiation results. e. a founder effect will occur. Help needed ASAP WILL GIVE BRAINLIEST AND 5 STARS RATE I AM SO BOREDDDDDDDDDDDDDDDD WHAT DO I DO?GIVE ME A LIST OF THING TO DO!PLZ Which of the following sentences uses correct pronoun-antecedent agreement?A. WNhen you cook the pasta sauces, remember to stir it frequently.B. The icicles looked so pretty on the roof that I tooka picture of it.C. The popcorn was burned in the microwave, so it did not taste right.D. The puppies were tired from playing outside, and it fell asleep quickly. A student made the Lewis dot diagram of a compound as shown. What is the error in the Lewis dot diagram?A. The Ca atom should transfer only one electron to Ci because the formula is CaCi.B. The number of dots around Ca should be one because Ca has to transfer only one electron to CI.C. The Ca atom should transfer only one electron to CI, and the second electron should be transferred to another CI atom.D. The CI atom should transfer two electrons to Ca because it has more electrons than Ca, so formula becomes CaCI*2 can you help me with this question (THIS IS A TEST) An old wedding photograph, which is rectangular, has a diagonallength of 13.6 inches and a height of 12 inches. Find the widthof the photograph.A 25.6 inchesC 4.7 inchesB 6.4 inchesD1.6 inches If a body having mass 40kg started moving initially with rest and it takes a velocity of 20m/sec in time 4 seconds. Find the value of force please help! i will mark brainliest if its right. Garbage! It smells bad and looks disgusting. Most people prefer not to think about trash more than once a day when they "take it out." We in the United States get rid of a great deal of garbage. In fact, we throw away 40 percent of all garbage in the world. Therefore, it is important that we, as Americans, recycle.Identify the argument in this passage. list four words that are often used as transition words showing the relationship of cause and effect. Help please! Ill give brainliest too! Im a little confused can someone help?? Was the age of napoleons, 1799-1815 successful or not? Kim saved $250 to buy new clothes for her summer vacation. She found several items she would like to buy, but is trying to decide if she has enough money to buy all the items she likes. She found a bathing suit for $35, two pairs of shoes for $15 each and five shirts with an average cost of $17 per shirt. She will have to pay 6% sales tax. If she buys all of the items, how much sales tax will she have to pay? Need help on this one.I JUST DONT WHAT TO DO IT Find f(5) if f(x)=|x+1|. Type a numerical answer in the space provided. Do not type spaces in your answer. . Lena thinks someone has stolen her identity. She isnt sure if she should place a fraud alert on her credit report. She doesnt understand anything about fraud alerts. What true statement could you teach Lena to help her make a more informed decision?A fraud alert prevents anyone from viewing your credit report.A fraud alert can stop anyone from opening any new accounts in your name.When filing a fraud alert, you must first pay for a credit report.To place a fraud alert, you must contact all three credit reporting agencies. The first Atlanta exposition was named in honor of Georgias crop.Who spoke at the third exposition on the issue of segregation? Called the Atlanta Compromise, his speech argued that African Americans should segregation. Given the graph of the function, determine the equation. (-4,3), (5, -6). Pls help