Answer:
List the phases for Meiosis I: Prophase I, Metaphase I, Anaphase I, Telephase I
List the phases for Meiosis II: Prophase II, Metaphase II, Anaphase II, Telephase II
During prophase I the chromosomes coil and become shorter.
Chromosomes that are the same size and have the same genes are called homologous chromosomes.
Each half of a replicated chromosome is called a chromatid.
Sister chromatids of a chromosome are identical copies of the same chromosome.
Explanation: I hope I helped and have a great day! ^-^
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Find the EXACT area of the shaded. The square has a side length of 24 meters.
Answer:
Explanation:
If the entire square is shaded and that 24m being the measurement of just one side just multiply 24 by 24 which is 576[tex]m^{2}[/tex]
If you are saying that 24 is the length of all of the sides combined just divide 24 by 4 to get one side and square it. 6 times 6 and you get 36[tex]m^{2}[/tex]
what is an example of primary ecological succession?
a. plants and animals invading an abandoned crop field
b. lichen growth on rocks
c. minerals spurring rapid plant growth
d. mangroves stabilizing the soils on tropical coasts
Answer:
mangroves stabilizing the soils on tropical coasts.
WILL GIVE BRAINLIEST!
what is micro organization?
Answer:
micro organisms are small organisms
Explanation:
Micro-Organisms are those organisms which are so Tiny that they can not be seen with the naked eyes but with the aid of an Electron microscope.
hope it helpful
please make me brainliest
Think about the variety of biomes on Earth and differences in their weather patterns. Which list shows environments from highest
average temperature to be lowest average temperature?
A) swamp, mountain, desert
B) swamp, desert, mountain
C) desert, swamp, mountain
D) mountain, desert, mounatin
Answer:
C
Explanation:
hope this helps
The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.
What are biomes?Since they belong to certain areas or zones that, due to their geographical characteristics, share a climate, vegetation, and wildlife, biomes provide the primary support for the harmony of nature.
Any biome can include a wide range of habitats because the term "biome" is more general than "habitat." An area's climate and geography determine the biome classification. Communities that have adapted to the unique climate and ecology of the biome make up each one. Depending on the surroundings, they come in a variety of forms. The temperate deciduous biome is the ideal environment for human habitation.
The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.
Learn more about biomes, here:
https://brainly.com/question/18601179
#SPJ6
Which of these can a wave carry from one place to another?
energy
matter
particles
water
Answer:
energy
Explanation:
hope its is correct!!
Explain how specific proteins are formed from a strand of mRNA.
Answer:
During translation, ribosomes move along an mRNA strand, and with the help of proteins called initiation factors, elongation factors, and release factors, they assemble the sequence of amino acids indicated by the mRNA, thereby forming a protein.
Explanation:
Answer:
Explanation:
Los ARN mensajeros, también conocidos como ARNm, son uno de los tipos de ARN que se encuentran en la célula. Éste en particular, como la mayoría de los ARN, se sintetiza en el núcleo y luego se exporta al citoplasma, donde la maquinaria de traducción, la maquinaria que realmente fabrica las proteínas, se une a las moléculas de ARNm y lee en ellas el código para producir una proteína específica. Así que en general, un gen, el ADN de un gen, puede ser transcrito en una molécula de ARNm que puede acabar dando lugar a una proteína específica.
ASAP Here is a nitrogen base sequence for a piece of one of the strands of a DNA molecule: ATTCGCGAT.
What would be the base sequence of the other complementary strand at this part of the DNA molecule?
Answer:
TAAGCGCTA
Explanation:
The music and pictures connected with a story can also show blas.
A
True
B.
False
Answer:
A
Explanation:
I took the question in a online quiz
What cellular function is negatively impacted by an increase in cell size?
Answer: c
Explanation:
Someone smart PLS HELP!!!!!!!!!!!!! Uranium-235 is a popular choice of fuel for nuclear reactors. But U-235 doesn't always fission the same way. Below are three ways it can split. Complete the nuclear equations so they balance.
fill in the blank line(s) pls pls pls pls pls pls help!!!!!!!
I’m 90% this is right
Sorry if I’m wrong
If a plant cell needs energy for endocytosis, what does it use and where does the energy come from?
Explanation:
Active transport uses energy stored in ATP to fuel the transport. ... Endocytosis methods require the direct use of ATP to fuel the transport of large particles such as macromolecules.
Hope this helps!
If a plant cell needs energy for endocytosis, its use and energy come from- Active transport from ATP.
Endocytosis is an energy-using process by which cells internalize molecules by engulfing them.
Endocytosis needs to use directly ATP to fuel the transport of large particles such as macromolecules, parts of cells that can be engulfed by other cells in a process called phagocytosis.Active transport is the movement of molecules across a cell membrane in the direction against their concentration gradient, i.e., moving from a low concentration to a high concentration and this uses cellular energy.Thus, If a plant cell needs energy for endocytosis, its use and energy come from- Active transport from ATP.
Learn more:
https://brainly.com/question/11877274
What are the answers here? Select all that apply.
Answer:
the first, second, fourth, and fifth
what is cell differentiation dependent on
many things
the number of chromatids
gene expression
the number of stages in the cell cycle
Answer:
many things..........
Which product of respiration is considered waste material and leaves the alveoli?
O oxygen
O water
O carbon dioxide
O carbon monoxide
Answer:
In our respiratory system, carbon dioxide is the waste material that we expel when we breathe out. The answer is C, Carbon Dioxide
I hope you have a great day!
The waste product of respiration is
C. Carbon dioxide
The oxygen consumed via stomata is used up by cells.
Respiration in leaves:Oxygen from the air enters a leaf through stomata and reaches all the cells by the process of diffusion. This oxygen is used in respiration in cells of the leaf. The carbon dioxide produced during diffuses out from the leaf into the air through same stomata. The oxygen used by cells in the leaves to disintegrate glucose into water and carbon dioxide.
Thus, option C is correct.
Find more information about Respiration here:
brainly.com/question/18169685
What are the genotypic and phenotypic distributions for the F1 and F2 generations from a cross between a chick with black (BB) feathers and chicken with white (WW) feathers if the color is determined by alleles that show codominance. The heterozygote is an erminette chicken, which is black and white speckled.
Answer:
Please find the punnet square to this question as an attachment
F1 generation:
genotype = BW
Phenotype = Erminette offsprings
F2 generation:
genotype = BB (1): BW(2): WW(1)
Phenotype = 1 Black, 2 Erminette, 1White
Explanation:
This question involves a gene coding for feather color in chickens. The allele for black feathers (B) is codominant with the allele for white feathers (W) to form an erminette chicken (black and white speckles).
According to this question, a cross between a chick with black (BB) feathers and chicken with white (WW) feathers will result in an all erminette chicken (BW) in the F1 generation (see attached image)
Also, in the F2 generation got by self-crossing the Erminette genotype in the F1 generation (BW), the following genotypic and phenotypic ratios are observed:
Genotypic ratio = BB (1): BW(2): WW(1)
Phenotypic ratio = 1 Black, 2 Erminette, 1White
What caused the chromosomal alteration in the number 21 chromosomes? (LS3.2) A. Part of one chromosome attached to another chromosome B. Some of the genes on a chromosome were reversed C. A duplicated chromosome failed to separate during meiosis D. A part of a chromosome was lost
Answer:
The correct answr is - A. Part of one chromosome attached to another chromosome.
Explanation:
Translocation is one of the chromosome abnormality that cause change in the number of the chromosome. In the translocation a part of the chromosome breaks off and bind or attached to the another chromosome.
The translocation cause various disorderes in individual one of them is Down syndrome which is the result of the alteration of chromosome number 21. In this translocation or specicifically the chromosome portion of chroromosme 14 breaks off and reattaches to the chromosome 21 result in one normal 14 and two normal 21 chromosme so there is trisomy occurs.
Answer:
A duplicated chromosome failed to separate (nondisjunction)
Explanation:
If nondisjunction occurs during meiosis I, homologous chromosomes fail to separate. This produces abnormal gametes that contain two members of the affected chromosome or none. This is why there is an extra chromosome in the 21 chromosomes.
What is a society that is able to survive and function over a specified time?
Answer:because time and society are different
Explanation:
Which of the following equations are balanced?
2Fe + Cu(NO 3) 2 → 2Cu + Fe(NO 3) 2
2K + 2H 2O → H 2 + 2KOH
Li + Cl 2 → LiCl
2H 2 + O 2 → 2H 2O
2S + 3O 2 → 2SO 3
Answer:
the second, fourth and fifth ones are balanced.
PLS HELP ASAP
Section 4: Answer the following analysis questions about your proposed solutions. 1. Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. 2 Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. 3. Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. 4. How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs?
Answer:
Section 4: Answer the following analysis questions about your proposed solutions.
Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. The Koalas won’t be extinct.
Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. They will impact because they will be helping.
Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. I would pick the food because they need to have protein to live longer.
How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs? If people want to see them at the zoo, then they should take care of them.
There u go!!!! Hope this helps.
And if someone else answers, can I have the brainliest?
Have an amazing day :D
Protein is found throughout the body—in muscle, bone, skin, hair, and virtually every other body part or tissue.
What is protein?It makes up the enzymes that power many chemical reactions and the hemoglobin that carries oxygen in your blood. At least 10,000 different proteins make you what you are and keep you that way.
Protein is made from twenty-plus basic building blocks called amino acids.
Because we don’t store amino acids, our bodies make them in two different ways: either from scratch, or by modifying others. Nine amino acids—histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine—known as the essential amino acids, must come from food.
Therefore, Protein is found throughout the body—in muscle, bone, skin, hair, and virtually every other body part or tissue.
To learn more about protein, refer to the link:
https://brainly.com/question/17095120
#SPJ5
Which details could be included in a biography of Frida Kahlo? Check all that apply.
a description of the first self-portrait Kahlo painted
a story about Kahlo’s childhood pet
an account of the accident in which Kahlo was seriously injured
Kahlo’s impressions of other artists of the time period
a description of a cousin Kahlo never met
an example of how Kahlo influenced artists who came after her
Answer:
The details that could be included in a biography of Frida Kahlo are:
1. a description of the first self-portrait Kahlo painted
3. an account of the accident in which Kahlo was seriously injured
6. an example of how Kahlo influenced artists who came after her
Explanation:
Frida Kahlo was a Mexican painter. She was born in Coyoacan, which at that time was a small bus stop on the outskirts of Mexico City. Her father was a painter and photographer of German-Jewish origin.
Kahlo began painting after a serious traffic accident in 1925. Her lifelong pain after the accident was the subject of many of her images. In addition to personal experiences, she also describes how hard life women lived. She was also influenced by the culture of the Mexican indigenous people, and portrayed them in bright colors, with a mixture of realism and symbolism.
Answer:
1 3 4 6
Explanation:
Explain why Hurricane Harvey traveled from the east (Africa) towards the west (Florida) when our weather in Wisconsin starts in the west and travels east?
PLEASE HELP!
Answer:
Due presence of Sahara desert that is responsible for the formation of this hurricane and its movement towards Florida.
Explanation:
Hurricane Harvey traveled from the Africa towards the Florida because these hurricane formed at the African region due to the presence of Sahara desert. The hot and dry wind of Sahara desert meets with the cool, moist air from the south produces these hurricane which then moves from the Africa to the west side where Florida is located so that's why Hurricane Harvey traveled from Africa towards the Florida.
A wetland that contains a mixture of fresh water and salt water is called
an estuary
a stream
a river.
a pond
Answer:
an estuary
Explanation:
A wetland which contains a mixture of fresh water and salt water is called as an estuary. Thus, the correct option is A.
What is an estuary?An estuary is an example of a partially enclosed, coastal water body where the freshwater from rivers and streams mixes up with the salt water from the ocean bodies. Estuaries, and their surrounding lands, are the places of transition from the land area to the sea area.
Estuaries and their surrounding wetlands are the bodies of water which are usually found where the rivers meet the sea. Estuaries are the home to many of the unique plant and animal communities which have adapted to the brackish water, which is a mixture of fresh water draining from the land and the salty seawater.
Therefore, the correct option is A.
Learn more about Estuary here:
https://brainly.com/question/17564221
#SPJ6
Summarize the possible applications of gene knockout GMOs.
Answer:
This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.
Explanation:
This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.
25. Which of these does natural selection work on?
a. Only animals
b. All populations
c. Only microscopic organism
d. Individuals
e. Only small
what type of species is a key element in keeping the ecosystem in balance
Answer:
predators keep the population of mice under control, insects pollinate flowers, and worms decompose leaf litter. All species are important and help keep the ecosystem balanced.
Explanation:
Answer:
keystone species
Explanation:
HELP ME WITH THIS PLEASE!!!!!!!
Answer:
c
Explanation:
Answer:
Primary consumer.
Explanation:
Ok, so a producer is stuff like grass. Then you've got decomposers, which are maggots and vultures and animals like that (ew). Our primary consumer is the bird, then you've got the snake which eats the bird, and then there's the alpha predator, the hawk, which can eat both the snake and the bird. We call the alpha predator the tertiary consumer.
Do you get it now?
Multiply (2x + 5)(3x - 4).
Answer:
6 [tex]x^{2}[/tex] + 7 x − 20
Which is NOT a function of lipids?
1.Absorption of Vitamins
2.Genetic Storage
3.Insulation/Cushioning
4.Energy
Lipids don't store genetic informations so the answer is 2
they absorb liposoluble vitamins they offer insulation/cushioning they store energy
Patients wear protective gear when being X-rayed. What substance is being protected directly from mutation?
Answer:
Radiation has a potential of causing germ cell mutations that may be passed on to future generations.
Explanation:
i think so, hopefully this helps;(
Ionizing radiation damage cells and cause double-strand breaks that let more DNA in. These additional fragments of DNA find their way to the nucleus and cause cellular mutations. Protective gears are worn to prevent this.
What are X-rays ?X-rays are a form of electromagnetic wave radiation. Using X-ray imaging, your body's interior can be visualized. The photos depict the various bodily parts in various shades of black and white. This is due to the fact that various tissues absorb radiation in different ways.
Ionizing radiation, a type of radiation that x-rays create, has the ability to destroy living tissue. This is a risk that gets worse the more exposures someone has over the course of their lifetime. However, exposure to radiation normally carries a low risk of acquiring cancer.
Therefore, protective gears are worn during x-rays to avoid mutations.
Learn more about X-rays, here:
https://brainly.com/question/2833441
#SPJ2