Question 1 of 10
What do proteins, carbohydrates, and lipids have in common?
O A. They are all made of chains of nucleic acids.
O B. They all use peptide bonds to bind amino acids.
O C. They are all formed from the same elements.
O D. They all contain the instructions for building organisms.

Answers

Answer 1

Answer: They are all formed from the same elements.

Answer 2

Answer: the answer is c

Explanation:


Related Questions

Using the diagram below, how many electrons will Be have if it is a neutral atom?

Answers

the answer is six electrons

Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid

Answers

Answer:

Lipid is the most likely answer.

Give two examples each of centripetal force​

Answers

Answer:

Spinning a ball on a string or twirling a lasso: Here the centripetal force is provided by the force of tension on the rope pulls the object in toward the centre. Turning a car: Here the centripetal force is provided by the frictional force between the ground and the wheels.

Explanation:

What is typical of cell reproduction when cancer cells are reproduced in a petri dish from a tissue culture? Check all that apply.

Answers

Answer:

Cells reproduce without limit. Cells reproduce with multiple cells

Tissue culture I haven’t studied that tho,....lkkeodkekfkeofk

question one : when two plates converge, they are what?

a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other

question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other

question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age

Answers

Q1. They are d. colliding with each other.

Q2. They are c. sliding along each other (in a processes called “subduction”)

Q3. Rocks furthest away from the ridge are b. oldest the further away you move from the ridge. The youngest rocks can be found closest to the mid ocean ridge.

what is the percentage of thymine in wheat ?

Answers

Answer:

27.1% or 27% if rounded

Explanation:

Hope this helps ya!!

When you exhale, what happens in the lungs?
A. Air moves from high pressure (in the lungs) to low pressure (outside)
B. Space in the lungs increases
C. Lung pressure decreases
D. Air moves from low pressure (in the lungs) to high pressure (outside)

Answers

Answer:

Conversely, exhalation moves the diaphragm up into the chest cavity and reduces the space in it. This forces the air, which is dense with carbon dioxide at that point, out of the lungs and windpipe. It then exits the body either through the nose or mouth. Usually, this requires no physical effort from the body.

Explanation:

So its A

are bones living or non living and why

Answers

Answer:

i think they are non living

Explanation:

because they dont have organs or blood or anything

Answer:

Bones are non living

Explanation:

1: Bones don’t movement on their own

2: Bones don’t have cells

3: Bones do bot breathe

4: They do not count on anything to survive

5: They are just something that helps a living organism to move

Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?

Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?

Answers

Answer:

Wedging (for the first one)

Explanation:

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?

Answers

The proton gradient produced by proton pumping during the electron transport chain is used to synthesize ATP. Protons flow down their concentration gradient into the matrix through the membrane protein ATP synthase, causing it to spin (like a water wheel) and catalyze conversion of ADP to ATP.

hurry due in five min plz help

Answers

Answer:

b

Explanation:

Answer:

d

Explanation:

I hope that helped!

Explain how one celled organisms get oxygen in water.

Answers

Answer:

n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.

Explanation:

Please Help me as soon as possible.

In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.

Answers

Answer:

The answer is; c

It is important to distinguish between codominance and incomplete dominance.

In incomplete dominance, the two alleles blend with each other in phenotype  giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.

In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.

Explanation:

A substance only composed of one kind of atom is a(n) *

Answers

Element is your answer

Explanation it is on the periodic table

The law of___________explains how traits are inherited through generations.

Answers

Answer:

the law of inheritance

What is H₂O - H₂+ boz

Answers

Answer:

-tH2

H20 - H2 + boz

0-H2t

-tH2

WILL GIVE BRAINLIEST!!!!!!
An amino acid is to a polypeptide as:

glycogen is to glucose.

testosterone is to a steroid hormone.

a phospholipid is to a plasma membrane.

a nucleotide is to a nucleic acid.

Answers

Answer would be D!
Mark brainliest


What would be the temperature at a depth of 2500 km?


Answers

Answer:

4700 Degrees Celsius

Explanation:

Which of the following statements supports the need for a handler to know an animal’s point of balance? A handler must know an animal’s pattern of movement in order to avoid injury. A handler must know where to stand in order to avoid injury. A handler must know proper feeding procedures in order to avoid injury. A handler must not use a loud voice in order to avoid injury.

Answers

Answer:

A handler must know an animal’s pattern of movement in order to avoid injury.

Explanation:

Point of balance refers to equalibrium so if you know the animals pattern of movemenrt you are less likely to get injured while moving on or with it.

Answer:

A

Explanation:

i got it wrong and it showed the correct answer

In eukaryotes the electron transport chain is composed of a series of electron carriers located in the blank of mitochondrion

Answers

Answer:

Facts that is right

Explanation:

In eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

The electron transport chain is composed of four large, multiprotein complexes. These protein complexes are formed of a series of electron carriers.

These complexes are embedded in the inner mitochondrial membrane and two small diffusible electron carriers shuttling electrons between them.These transfer electrons from electron donors to electron acceptors via redox reactions and joins this electron transfer with the transfer of protons across a membrane.

Thus, in eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

Learn more about:

https://brainly.com/question/7135096

4) How does climate affect ecosystems and the life within them?

Answers

Answer:

Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.

What components are needed for
photosynthesis?

Answers

Answer:

sunlight, carbon dioxide, and water as substrates

Explanation:

Hope this helps :]

Answer:

Explanation:

chicken leg piece and/Photosynthesis is a multi-step process that requires sunlight, carbon dioxide, and water as substrates. It produces oxygen and glyceraldehyde-3-phosphate (G3P or GA3P), simple carbohydrate molecules that are high in energy and can subsequently be converted into glucose, sucrose, or other sugar molecules.

Give two examples of why water is important to the human body.

Answers

Answer: Your body uses water in all its cells, organs, and tissues to help regulate temperature and maintain other bodily functions. Because your body loses water through breathing, sweating, and digestion, it's important to rehydrate by drinking fluids and eating foods that contain water.

fill in the complementary bases according to the base-pair rule.

a | t | c | c | g | a | t | a | g | c | t | t | a | g

Answers

t/a/g/g/c/t/a/t/c/g/a/a/t/c

What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?

Answers

Hhhyyyyyggvvvvvvbhhhhhyyyyyggggghgggggffcvvvfffffffhz gzmysmydyysudkdjdisrw and the dttyyuuuuiiiiuuuuu

A water molecule is attracted to another water molecule. This is an example of

Answers

This is an example of cohesion. :)

100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content

Answers

Answer:

B

Explanation:

YOOOOOOOOOOOOOOOOOOOOOO

ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule? What happens to the other 66%?

Answers

Answer:

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule is because of  the process of cellular respiration. And what happens to the other 66% is that it's  used to make water from hydrogen ions and oxygen that converted to heat and used directly for energy to store as fat

Explanation:

ASAPPPP!!!!
Write step by step instructions for making a protein

Answers

Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. Transcription is the transfer of genetic instructions in DNA to mRNA in the nucleus. It includes three steps: initiation, elongation, and termination.

Other Questions
Oakland Tax Planning Service bought computer equipment for on January 1, 2018. It has an estimated useful life of four years and zero residual value. Oakland uses the straightline method to calculate depreciation and records depreciation expense in the books at the end of each month. Calculate the amount of Depreciation Expense for the period, January 1, 2018 through September 30, 2018, for this equipment. (Round any intermediate calculations to two decimal places, and your final answer to the nearest dollar.)A. $6,000B. $6,500C. $4,500 D. $5,000 Mentionnez-vous souvent vos difficults vos parents? You purchase 3 items for $4.23. About how much did you spend?$15$10$12$13 What is the simplified form of the expression V-64? Somebody help me fastThis is correct?! What did the Texans declare in the Turtle Bayou Resolutions One number is 5 greater than another. The product of the numbers is 36.Find the numbers. Which letter is silent in Spanish?O A. hO B.jO C. gO D. Y Change the sentences below into questions using 2) Translate the sentences below and your questions into English.(20%)1. 2. 4. Which excerpt from A Man's World contains a stage direction?O FRITZYou are tired to-night, Yah? Un?O FRANKNow-now-Fritzieif you get fidgety-O FRITZ(Sitting at L. of desk.) Nobut you-O FRANKKiddie will be the end of everything for me. I need a republican. Plz give me a reason on why your on your side PLEASE HELP ME I NEED THIS ASAPWhat is the Out of Africa Theory?It calculates that human migration from Africa began 10,000 to 20,000 years ago.It calculates humans evolved to bipedal hominids around 10,000 years ago.It calculates humans evolved to bipedal hominids around 50,000 years ago. It calculates that human migration from Africa began 60,000 to 90,000 years ago. when ------, you change a number to one that is less exact, so it is easier to work with. please help me in have 10 minutes left Right now I have an i5 2400 and a PYN XLR8 gaming GTX 1650 Super, my CPU is too weak for 1080p gaming, what CPU should I get that has a B75 LGA 1155 socket, or Overclock it if so how many GHz should I overclock it to(I only have a stock cooler) the product of the sum and the difference of 8x and 4y For this reaction, C3H8(g) + 5 O2(g) 3 CO2(g) + 4 H2O, the H is 2200 kJ. If two moles of C3H8(g) reacted with excess oxygen, what would be true?A) 4400 kj of heat released into surroundingsB) 4400 kj of heat absorbed by system C) 1100 kJ heat released into surroundings D) 1100 kJ heat absorbed by system QUESTION 15Which grouping represents all non profit organizations?United Way, Red Cross NAACPCaesars, Bally, Borgota and Boys & Girls ClubsNike, Nordstrom, Kohls and KelloggsFeed America, Dress for Success, American Civil Liberties Union and McDonalds help pleae look at the picture! During the 1930s the United States followed a foreign policy of isolationism. Which is the best example of that policy?forbidding Americans to travel overseasbuilding up the nations armed forcesavoiding alliances with other nationsfavoring Great Britain over the rising power of Nazi Germany Can someone explain this to me pweaseee