The arrows in the picture below show several ways heat is transferred from the Sun as it strikes sand on the surface of a beach. Which arrow shows convection?

A.
1

B.
2

C.
3

D.
4

The Arrows In The Picture Below Show Several Ways Heat Is Transferred From The Sun As It Strikes Sand

Answers

Answer 1
4 shows convention because the heat is coming from out of the ground into the atmosphere
Answer 2

Arrow 4 show convection. Thus option 4 is correct.

What is convection ?

The process in which transfer of heat occurs by movement of a heated fluid either air or water called as convection.

Initially the heat transfer through conduction, however a bulk heat transfer takes place due to the motion of the fluid.

The mechanism of convection involved,  fluid is heated from below, leads to thermal expansion.

So that the lower layers,  which are hotter now, become less dense.

So the less denser layer replaced by colder layer due to buoyancy nd colder layer is more dense.

This process continuously occur  and heat transfer occur through convection

It  occurs in both liquid and gases, may be natural or forced, bulk transfer occur.

Thus option 4 is correct.

Learn more about convection, here:

https://brainly.com/question/4138428

#SPJ2


Related Questions

What are winds that blow in a certain direction most of the time and can produce surface currents called?

the Coriolis effect

surface winds

prevailing winds

ocean winds

Answers

Answer: surface winds

]How does emphasis on agricultural technology today compare to the recent past?


Today scientists are only concerned with the nutrition of livestock, not with size or quantity.

In the past, scientists were concerned with mass-producing for local areas, not for large areas.

In the past, scientists have not been concerned with the well-being of livestock or crops.

Today scientists are devising ways to use advancements in positive ways for the environment.

Answers

Answer:

In the past, scientists were concerned with mass-producing for local areas, not for large areas.

Explanation:

Today agriculture is made on a more global scale

Dominic made the table below to organize his notes about mixtures. A 1-column table. The first column labeled properties of mixtures has entries has no set composition, must have more than one state of matter, must have more than one substance. What mistake did Dominic make? A. The title should read “Properties of Solutions” because some mixtures do not have all of the properties listed. B. There is a definite recipe to make each mixture, so the composition of a mixture is set. C. Although it is possible to have more than one state, it is also possible to have only one state. D. A single substance can be used to make a mixture if the substance is composed of more than one element.

Answers

Although it is possible to have more than one state, it is also possible to have only one state.Explanation:

Reflection Questions
1. Explain how biological evolution is supported by the fossil record.
2. Why is natural selection a mechanism for biological change?
3. How does chemical evolution explain the origin of life on Earth?
4. Explain why scientific theories, such as biological and chemical evolution, represent the
strongest explanation of the changes observed in the fossil record.
5. How can scientific theories on evolution and the fossil record change over time?

Answers

Answer:

1) The word ‘evolution’ was first mentioned in the book ‘The Origin of Species’ in 1859, by Charles Darwin. Darwin put forward the concept of evolution during his journey to the Galapagos Islands. 

2)Natural selection is an important mechanism of evolution. It states that the organisms that are able to survive and reproduce with the changing environmental conditions are selected by nature while the ones that cannot survive are eliminated.

3) Evolution mainly deals with the origin of life on earth. The conditions and the forms of life on earth were entirely different from what we see today.

please forgive me I cant answer 4th one..

5)Charles Darwin, an English naturalist of the 19th century made an extensive study of nature for over 20 years. 

1. The fossil record provides crucial evidence for biological evolution. Fossils are the preserved remains or traces of past organisms, providing a record of life on Earth over millions of years.

By studying fossils, scientists can observe changes in organisms and their characteristics over time. Fossils show a progression of simpler life forms in older layers to more complex ones in more recent layers.

2. Natural selection is a mechanism for biological change because it leads to the adaptation of populations to their environments over time. It is based on the concept that individuals within a population exhibit variation in traits, and those traits that enhance survival and reproduction are more likely to be passed on to future generations.

Through natural selection, individuals with advantageous traits have higher chances of surviving and reproducing, leading to the increased frequency of those traits in subsequent generations.

3. Chemical evolution, also known as abiogenesis or prebiotic evolution, explains the origin of life on Earth by proposing that life arose from non-living matter through a series of chemical reactions.

According to this theory, in Earth's early conditions, simple organic molecules formed from inorganic compounds through processes like lightning, volcanic activity, and reactions in the atmosphere and oceans.

These molecules then underwent further reactions, leading to the formation of more complex molecules like amino acids and nucleotides, which are the building blocks of proteins and nucleic acids, respectively.

4. Scientific theories such as biological and chemical evolution represent the strongest explanations for the changes observed in the fossil record because they are supported by extensive evidence from multiple scientific disciplines.

These theories have withstood rigorous testing, scrutiny, and peer review over many years. They are based on a large body of evidence, including the fossil record, comparative anatomy, genetics, molecular biology, and observations of natural populations.

5. Scientific theories on evolution and the fossil record can change over time as new evidence is discovered, technologies advance, and scientific understanding improves.

The process of scientific inquiry involves continuous investigation, testing, and refinement of theories based on new data and observations.

As scientists gather more evidence from fossil discoveries, genetic studies, experimental research, and other fields, our understanding of evolution and the fossil record can deepen and evolve.

Know more about the fossil record:

https://brainly.com/question/7671909

#SPJ4

Which of the following cellular processes will be involved in the growth, development, and reproduction of the offspring?
a. meiosis only
b. mitosis only
C. both meiosis and mitosis
d. neither meiosis nor mitosis

Answers

A - meiosis only
Explanation

Answer:Both Mitosis and meiosis

Explanation:

Cell face both conditions for the development of new offspring

what is the howler monkeys biome

Answers

Predominantly inhabit rain forest ecosystems

Scott made a model of the water cycle by filling a tub with water, covering the tub with clear plastic, and placing a heat lamp over the tub. After a few days, he observed water droplets collecting on the plastic wrap.
What process formed the water droplets in Scott’s model?

evaporation
transpiration
condensation
precipitation

Answers

Evaporation ...................
The answer is condensation
water which collects as droplets on a cold surface when humid air is in contact with it.

A protein may fold incorrectly if_________ brings the wrong amino acid to the ribosome to assemble the protein.

Answers

YOUR ANSWER IS tRNA because the mRNA sends out a message to the tRNA and the tRNA brings back the appropriate amino acid but if the tRNA where to bring back the wrong the protein could fold incorrectly.

If tRNA does not bring back the appropriate amino acids, the protein may fold incorrectly. so, the blank is tRNA.

What is tRNA?

The type of RNA that helps in the synthesis of proteins from mRNA, called as tRNA. tRNA acts as an adapter molecule during the translation process, and as an adapter, it connects amino acids to nucleic acids. It carries the amino acids that are added to the peptide chain and decodes the same codons in the mRNA molecule.  

The structure of tRNA can be separated into primary, secondary and tertiary structures. The structure tRNA has four arms (the acceptor, D, anti-codon and -arms), three loops (D, anti-codon and -loop) and a variable region.

It binds amino acids to specific codons present in the mRNA, by acting as an adapter. Therefore, If tRNA bring wrong amino acid to ribosome for assembly of protein, protein may fold incorrectly.

Learn more about tRNA, here:

https://brainly.com/question/29775087

#SPJ2

what is the connection between chromosomes and the heavily muscled phenotype??
Uses these vocab terms or phases in the short answer response: allele, chromosomes , heavily muscled, myostatin protein

Answers

Answer: The genotype of an organism is defined as the sum of all its genes. The phenotype of an organism is the observable physical or biochemical characteristics of an organism, determined by both genetic make-up and environmental influences.

Explanation:

im confused its more science but yah oof
Use the photo to answer the question.



The devastation from the landslide shown—the disturbed soil, the knocked-over trees, the blocked waterways and road—are evidence that the change happened Response area over time.
their is to answers rapidly or slowly

Answers

rapidly rapidly rapidly
rapidly is the correct answer.

Can SOmeone do this for meh... I just got back home and im tired ;L

Firmly hold with one hand the end of a ruler (or similar object) over the edge of a table. Pull the other end down gently and listen to the sound. Then give the ruler (or similar object) a harder downward pull, and see if there is a difference in sound. Describe what you hear and explain the difference using the terms “energy,” “amplitude,” “intensity,” and “decibel.”


2. Take some time to listen to sounds in your environment. Make a list of ten sounds, ranking them from the highest pitch to the lowest. Write a couple of sentences describing whether this was easy or difficult and why. (Some of the sounds can come from tapping objects that vibrate or playing musical notes on an instrument.)

Answers

Don’t click it they are hackers

1. What is the value of the AMPLITUDE for WAVE A?
2. What is the value of the WAVELENGTH for WAVE A?

Answers

Answer:

Sorry I really just needed the points   ;(

Explanation:

Answer:

1) Amplitude of wave A: 0.5 meters

2) You would have to find the wavelength with the equation λ = [tex]\frac{v}{f}[/tex]

Explanation:

1) Amplitude of a wave is the height of the wave from the horizontal line drawn on "0" to the highest point on the wave.

2) λ is lambda, sign for the wavelength. V is the velocity of the wave, and F is the frequency of the wave.

Hope this helps!

Glucose, Starch, and cellulose are this type of molecule that is produced by plants *
A.lipids
B.proteins
C.carbohydrates
PLS HELP

Answers

C. Carbohydrates

Hope you find this helpful

Carbohydrates just did this test hope u get it right

TRUE/FALSE: When only water molecules diffuse through a cell's membrane, the process is referred to as hydrolysis.

Answers

Answer:

False

Explanation:

The correct answer is osmosis

Answer:

false

Explanation:

Make a Punnett Square for two smooth seed hybrid pea plants (Ss).

Answers

Answer:

Hope this helps!

He/She is correct, just so know and don’t second guess

can u plz explain the role of the digestive, endocrine, and excretory systems in maintaining homeostasis.

Answers

Answer:

Following are the roles of the digestive, excretory and endocrine systems in terms of homeostasis:

The endocrine system regulates the secretion of various hormones and homeostatic mechanisms in response to signals of the hypothalamus and pituitary glands.The excretory system maintains homeostasis by purifying the blood and getting rid of toxic waste from the  blood.The digestive system is mainly involved in the transfer and regulation of nutrients from food.

Explanation:

Role of Endocrine System:

The endocrine system mediates all the chemical signaling in the body.

Hormones are chemical messengers that the endocrine system uses to maintain chemical homeostasis.

Endocrine system manages glucoregulation by controlling the secretion of the hormones glucagon and insulin by the pancreas. Low and high blood sugar levels are sensed by the brain which then signals the endocrine system to release glucagon and insulin respectively.

The endocrine system is also indirectly involved in thermoregulation. A low core temperature signal received by the hypothalamus initiates the release of TSH by the pituitary gland and then that of T3, T4 thyroid hormones that stimulate shivering thermogenesis in the skeletal muscles.

Role of Digestive System:

The digestive system regulates the amount of nutrients absorbed in the body.

Although the absorption of nutrients in food is not exactly according to bodily needs, the absorption of dietary iron and calcium is strictly regulated by the digestive system.

Role of Excretory System:

The excretory system carries out osmoregulation which is the maintenance and regulation of water and salt levels in the blood.

The excretory system regulates the excretion of toxic waste from the blood.

Excess water, salts, urea and bilirubin (produced as a result of RBC break down) are some of the excretions.

please mark me as brainliest

Answer:

Following are the roles of the digestive, excretory and endocrine systems in terms of homeostasis:

The endocrine system regulates the secretion of various hormones and homeostatic mechanisms in response to signals of the hypothalamus and pituitary glands.

The excretory system maintains homeostasis by purifying the blood and getting rid of toxic waste from the blood.

The digestive system is mainly involved in the transfer and regulation of nutrients from food.

Explanation:

Role of Endocrine System:

The endocrine system mediates all the chemical signaling in the body.

Hormones are chemical messengers that the endocrine system uses to maintain chemical homeostasis.

Endocrine system manages glucoregulation by controlling the secretion of the hormones glucagon and insulin by the pancreas. Low and high blood sugar levels are sensed by the brain which then signals the endocrine system to release glucagon and insulin respectively.

The endocrine system is also indirectly involved in thermoregulation. A low core temperature signal received by the hypothalamus initiates the release of TSH by the pituitary gland and then that of T3, T4 thyroid hormones that stimulate shivering thermogenesis in the skeletal muscles.

Role of Digestive System:

The digestive system regulates the amount of nutrients absorbed in the body.

Although the absorption of nutrients in food is not exactly according to bodily needs, the absorption of dietary iron and calcium is strictly regulated by the digestive system.

Role of Excretory System:

The excretory system carries out osmoregulation which is the maintenance and regulation of water and salt levels in the blood.

The excretory system regulates the excretion of toxic waste from the blood.

Excess water, salts, urea and bilirubin (produced as a result of RBC break down) are some of the excretions.

If you are looking at the general pattern of temperature and precipitation for an area over time, you are looking at the ______?______

Answers

Answer:

Earth's Surface rise and climate. You are basically looking at the weather and the condition of the atmosphere.

Explanation:

When the average temperature at the Earth's surface rise, evaporation occurs more which causes precipitation to also occur more.

Answer:blue

Explanations :

Why should God’s Natural Moral Law be the foundation for all other laws? (i can't fnd religion so i just put it in biology)

Answers

It’s fair and it’s mainly about love and respect for one another

Can octopuses grow their fangs back?

Answers

Answer:

hi

Explanation:

i think they can't.But they can regrow their arms

have a nice day

Large scale change is needed to combat climate change, but according the the author, cooperative work is best done in groups of what size?



155-300


501 and up


150 or less


301-500

Answers

You need to give us the text, how would we know what to answer if we don’t know what text were reading. All I can help you with so far is to reread the text and see what the author says
We need more context to answer this

PLS HELP
Flocabulary

Answers

Answer:

im pretty sure its B

Explanation:

Which statement best describes how panting after running helps a person's body maintain homeostasis? EXPLAIN THE ANSWER

A). It keeps the person's body warm when it is cold outside.


B). It rids the body of harmful organisms in the respiratory tract.


C). It brings more oxygen into the body to help meet increased energy needs.


D). It signals the body to start exercising to prevent getting out of shape.

Answers

I think it’s c but I’m not sure
D I put that and got it righteous good luck

Plss help me with this one for. science i can't figure this out i need help

Your team is provided with two test materials, C and D. You test the two materials using the air hockey table to collide Object A with Objects C and D. The test material objects are the same size and shape and are very similar in mass. The results are shown in the diagram. The sizes of the arrows are proportional to the acceleration.

Apply Newton’s laws to determine which of these materials is more suitable as a liner for a safety
helmet. Explain your answer.

Answers

Answer:

the annswer is b

Explanation:

just look at the questin and then see wicth one you can cross off

The three fundamental laws of classical mechanics known as Newton's laws of motion describe how an object's motion and the forces acting on it interact. The materials is more suitable as a liner for a safety helmet exists B.

What is meant by Newtons law?

The three fundamental laws of classical mechanics known as Newton's laws of motion describe how an object's motion and the forces acting on it interact. The following is a paraphrasing of these laws: Unless a force acts upon a body, it remains at rest or in continual straight-line motion. First Law of Motion of Newton Unless influenced by an imbalanced force, an item at rest stays at rest, and an object in motion keeps moving in a straight path at a constant pace.

According to the first law, unless a force acts on an object, it will not alter its motion. According to the second law, an object's force is determined by multiplying its mass by its acceleration. According to the third law, when two objects interact, they exert equal-sized and opposite-direction forces upon one another.

The materials is more suitable as a liner for a safety helmet exists B.

To learn more about Newtons law refer to:

https://brainly.com/question/14222453

#SPJ2

How can the energy stored in the photosynthetic organism be used?

Answers

Through photosynthesis, certain organisms convert solar energy (sunlight) into chemical energy, which is then used to build carbohydrate molecules. The energy stored in the bonds to hold these molecules together is released when an organism breaks down food. Cells then use this energy to perform work, such as movement.

☁️ Answer ☁️

1: "Through photosynthesis, certain organisms convert solar energy (sunlight) into chemical energy, which is then used to build carbohydrate molecules."

2: "The energy stored in the bonds to hold these molecules together is released when an organism breaks down food. Cells then use this energy to perform work, such as movement. "

-GoogIe

(And I love your pfp)

Hope it helps.

Have a nice day noona/hyung.

Melanie took two identical thermometers, one with its bulb painted black and the other with its bulb painted white. She kept a lighted lamp at equal distance from the two thermometers.

Which thermometer will show a higher temperature after an hour?

Thermometer with black bulb, because black reflects less heat than white


Thermometer with black bulb, because black absorbs less heat than white


Thermometer with white bulb, because black reflects more heat than white


Thermometer with white bulb, because black absorbs more heat than white

Answers

Answer:

A

Explanation:

Answer:

A

Explanation:

Limiting factors are divided into two categories. What are they? Give an example of each.Limiting factors are divided into two categories. What are they? Give an example of each.

Answers

Answer:

Limiting factors fall into two broad categories: density-dependent factors and density-independent factors. These names mean just what they say: Density-independent factors have an impact on the population, whether the population is large or small, growing or shrinking.

the density-dependent factor example is:

Density-dependent factor, also called regulating factor, in ecology, any force that affects the size of a population of living things in response to the density of the population (the number of individuals per unit area).

the independent factors example is:

Pollution. Like other density independent factors, pollution is a good example of a density independence.

Explanation:

pls mark brainliest

Some examples of limiting factors are biotic, like food, mates, and competition with other organisms for resources. Others are abiotic, like space, temperature, altitude, and amount of sunlight available in an environment. Limiting factors are usually expressed as a lack of a particular resource.

What other agricultural technique was used to mitigate the pink bollworm from destroying Bt cotton crops?

Answers

Cultural Control
Eliminate the food supply for pink bollworm by cutting off irrigation early enough to stop production of green bolls by early September. Regardless of when the crop is terminated, immediately shred the cotton plants following harvest.

I hope u find it helpful

Plsss help me with this its science
Make a general comparison of those planets closer to the sun with those farther from the sun,
based on the data below.

Answers

Answer:

Planets that are farther tend to have gas surfaces, a bigger diameter, and more moons. Planets closer to the sun have the opposite.

IF YOU ANSWER ALL THESE QUESTIONS AND THERE ARE CORRECT YOU WILL GET BRAINLEAIST
1. Which part of the flower produces sperm?
2. Which part of the flower attracts pollinators, like bees?
3.What is the name of the male reproductive organ of the flower?
4.What is the function of the stamen?
5. What holds up the stamen?
6. What are the male reproductive parts of the flower?

Answers

Answer:

1. The anther produces the pollen grains that contain the sperm needed for fertilization

2.Petals attract the pollinators.

3.Stamens are the male reproductive organ

4.The main function of the stamen is to produce the pollen grains, which house male gametes , necessary for reproduction.

5.The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up.

6.A stamen consists of an anther (which produces pollen, the male reproductive cell) and a filament.

please mark as brainlsit if it helps

Answer:

1. the anther

2. showy petals and sepals, nectar guides, shape, size, and color.

3. stamen

4. The pollen-producing part of a flower, usually with a slender filament supporting the anther.

5. the anther and filament

6. anther, filament, pollen

Explanation:

gene that is typically observed

Answers

Answer:

it think it is the marker gene it said that online for me I dont know

if that even is a gene

Answer:

yes

Explanation:

Other Questions
The Finishing Department had 6,800 incomplete units in its beginning Work-in-Process Inventory which were 100% complete as to materials and 40% complete as to conversion costs. 18,600 units were received from the previous department. The ending Work-in-Process Inventory consisted of 3,800 units which were 50% complete as to materials and 40% complete as to conversion costs. The Finishing Department uses first-in, first-out (FIFO) process costing. How many units were started and completed during the period What is a theme of "in Just-"? Children should not trust strangers. O Children cannot relate to adult problems. Spring is a joyful time Outdoor play is more fun than indoor play. Plz answer quickly will you brainlist why did weimar Republic collapse Find the value of x. 2 3 6 Match the value chain activity in the left column with the scenario in the right column.Value Chain ActivityScenario1.Service activities2.Inbound logistics3.Marketing and sales activities4.Firm Infrastructure5.Human resource management6.Technology7.Procurement8.Outbound logistics9.OperationsChoose from:Assembly line, Buying (sourcing) raw materials, CEO and CFO, Delivery to the firm's customer, New-product development, Receiving dock and raw materials, Surveys for prospect customers, Warranty work, Worker recruitment Describe how the Spanish-American War was started? In 2020 Klusic LLC purchased and placed into service two assets, furniture (7-year property) on April 24 with a basis of $11,000 and computer equipment (5-year property) on November 18 with a basis of $15,000. Calculate the maximum depreciation expense for 2021, (ignoring 179 and bonus depreciation).) (Round final answer to the nearest whole number.) a. $2,714. b. $7,494.c. $4,572 d. $8,282.e. None of the choices are correct. Suppose that the willingness to pay of several fans for Ducks football tickets is shown in the table below.Poppy likes to eat hot peppers. A coworker brought Poppy a jar of extremely hot ghost peppers. The accompanying graph illustrates Poppy's total utility for these peppers.Use the graph to answer the question and assume that Poppy seeks to maximize her utility. Write chemical equations for the following reactions. Classify each reaction into as many categories as possible: 15) Water and dinitrogen pentoxide gas react to produce aqueous hydrogen nitrate.Write chemical equations for the following decomposition reactions. 18) Aluminum oxide (s) decomposes when electricity passes through it.Predict whether the following single-replacement reactions will occur. If a reaction occurs, write a balanced equation for the reaction. 21) K(s)+ZnCl_2(aq)->, 24)Al(s)+Pb(NO_3)_2(aq)-> (symbol _ represent a subnumber).Write the balanced chemical equations for the following double-replacement reactions. 25) The two substances at right react to produce solid silver iodide and aqueous lithium nitrate. A treaty that can be signed between two or more countries to lower tariffs and improve the import and export of goods is a free trade.a. Trueb. False Ali will repair his car tomorrow (change into causative)?What is the answer? Population density is a measurement of population per unit area or unit volume.A TrueB False Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed why could one argue that the typical word superiority effect findings are counter intuitive