Tongue rolling is a dominant trait. Explain why it is possible for both parents being able to roll their tongue but their biological child is not able to do so.

Answers

Answer 1
The parents are heterozygous so when they have a kid they got the ressesive trait so they can’t roll there tongue
Answer 2

Answer:

The answer is 0 ( AKA A )

Explanation:

Parents form the same type of gene, which is Rr. Since all the genes are the same, there can not be a chance that the offspring can not roll the tongue. Next time focus on your work!! :3


Related Questions

How might change in one population affect other populations?

Answers

The food chain will mess up.

Classify each of the bones in the chart below as either long, short, flat, or irregular by placing a check mark in the appropriate column. Also use a check mark to indicate whether the bone is a part of the axial or the appendicular skeleton. Use Figure 8.1 as a guide. Axial Appendicular Short Flat Irregular skeleton skeleton Long Sternum Radius Parietal bone (cranial bone) Phalanx (single bone of a digit) Vertebra

Answers

"The classification of each bone according to its type (long, short, flat, irregular) and whether it belongs to the axial or appendicular skeleton:

Bone                          Type                              Axial Skeleton                          Appendicular Skeleton

Sternum                           Flat                                   ✔

Radius                           Long                                                                                         ✔

Parietal bone                   Flat                                   ✔

Phalanx (single bone)   Long                                                                                          ✔

Vertebra                           Irregular                            ✔

Long Bones: The bones that are longer than they are wide are called long bones. These bones are found in the appendicular skeleton of the body. The Radius bone is an example of a long bone.

Short Bones: Short bones are as long as they are wide. They are primarily found in the wrist and ankle. The phalanx bone is an example of a short bone.

Flat Bones: Flat bones are thin and flat. These bones protect vital organs and provide a surface for muscle attachment. The Sternum bone is an example of a flat bone.

Irregular Bones: Irregular bones have irregular shapes. These bones play a vital role in protecting the nervous system and the organs in the thorax. The Vertebra bone is an example of an irregular bone.

Axial Skeleton: The axial skeleton consists of bones that lie along the longitudinal axis of the body. The Vertebra and Parietal bone is a part of the axial skeleton.

Appendicular Skeleton: The appendicular skeleton consists of bones that lie along the appendages of the body. The Radius and Phalanx are a part of the appendicular skeleton.

Bones in the human body serve several important functions:

1. Support: Bones provide structural support to the body, giving it its shape and framework. They form the rigid framework that supports and maintains the body's posture.

2. Protection: Bones act as protective coverings for vital organs. For example, the skull protects the brain, the rib cage protects the heart and lungs, and the vertebrae protect the spinal cord.

3. Movement: Bones, along with joints, muscles, and tendons, enable movement. They act as levers that are moved by muscle contractions, allowing us to walk, run, lift objects, and perform various activities.

4. Blood Cell Production: Bones house bone marrow, where red and white blood cells, as well as platelets, are produced. Red blood cells carry oxygen, white blood cells help fight infections, and platelets are essential for blood clotting.

5. Mineral Storage: Bones store minerals, primarily calcium and phosphorus, which are crucial for maintaining the body's mineral balance. When the body needs these minerals, bones release them into the bloodstream.

6. Energy Storage: Yellow marrow, found in the central cavities of long bones, stores fat as an energy reserve for the body.

7. Body Support and Balance: Bones provide support for soft tissues and muscles, allowing them to function effectively. They also contribute to maintaining balance and stability.

8. Sound Transmission: Bones in the middle ear, such as the ossicles (malleus, incus, and stapes), transmit sound vibrations from the outer ear to the inner ear, facilitating hearing.

These functions collectively make bones essential for the body's structure, movement, protection, and overall physiological well-being.

To know more about bones visit:

https://brainly.com/question/412179

#SPJ11

What are the factors that increase a species success over time.

Answers

Answer:

Explanation:

(1) the potential for a species to increase in number,

(2) the heritable genetic variation of individuals in a species due to mutation and sexual reproduction,

(3) competition for limited resources

(4)  the proliferation of those organisms that are better able to survive and reproduce in the environment

Hope this helped!!!

state two factors on which the gravitational force between two objects depends.​

Answers

Answer:

Gravitational Force depends on two factors:

1. Product of mass of two object

2. Square of distance between their centers

Mathematically,

  F = G *(m1* m2)/d²

Explnation:

3) identify and describe three abiotic characteristics of ecosystems. Give an example of how each

characteristic could be affected by a human activity

Answers

Answer:

The abiotic characteristics of an ecosystem that affects man includes: Land surface, rainfall and relative humidity.

Explanation:

In the ecosystem, man occupies the terrestrial habitat which is affected by the abiotic factors listed above.

Abiotic (non- living) factors determine the type of biotic (living) community that is found in an ecosystem. These factors include Land surface, rainfall and relative humidity, just to mention a few.

--> LAND SURFACE: This is responsible for the marked variation in the vegetation of a place. For example, a mountain in the tropics may have a rain forest vegetation at it's base and an afroalpine vegetation near its peak. The gradient of the slope affects the growth of organisms. A steep slope encourage fast run - off of water and therefore encourages erosion, which results in shallow and infertile soil. This in turn AFFECT man's farming activities as there would be little to no crop yield.

--> RAINFALL: Water is a very important abiotic factor that affects life. The main source of water to terrestrial habitat is rainfall. When rain falls, a greater percentage of it sinks into the soil while the rest run- off into water bodies. Water is absorbed by root hairs into the plant and used for photosynthesis to produce food. The absence of rainfall in the environment of man could lead to drought which AFFECTS man negatively.

--> RELATIVE HUMIDITY: This is a measure of the amount of moisture in the atmosphere. It's usually high in hot wet regions. It affects the rate at which water evaporates from the body surfaces of organisms. Low relative humidity cause more water (sweat) to evaporate from body surfaces giving the human body a cooling effect. But in high relative humidity, the sweat cannot evaporate leaving the body feeling hot and sticky. This AFFECTS man as the body tries to cool off in a harder way by increasing rate of respiration and depth of blood circulation.

Witch statement about human activity and the environment is NOT true?

Answers

No body can help u cuz where is the picture
are there answer choices?

cystic fibrosis is a genetic disease that leads to the production of excessive thick mucus in the respiratory tract, leading to frequent and serious respiratory infections. the defect is due to the production of a faulty membrane protein for the transport of the chloride ion. the protein is still in the membrane; it just doesn't function normally. what type of membrane protein is being affected in this case?

Answers

The type of membrane protein that is affected in cystic fibrosis is a chloride ion channel.

What is Cystic fibrosis?

Cystic fibrosis is an inherited condition in which the mucus in the body becomes thick and sticky. It can cause breathing difficulties and frequent infections, among other symptoms. Because the mucus is thicker than normal, it can obstruct the ducts of the pancreas, preventing digestive enzymes from reaching the small intestine.Cystic fibrosis is an autosomal recessive genetic disorder.

This means that in order to inherit the disease, a person must inherit two copies of the mutated gene, one from each parent.

What is the cause of cystic fibrosis?

Cystic fibrosis is caused by a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The CFTR gene provides instructions for making a protein called the cystic fibrosis transmembrane conductance regulator. This protein functions as a chloride ion channel, which helps regulate the flow of salt and fluids in and out of cells.

However, in people with cystic fibrosis, the CFTR protein is either missing or not functioning properly due to a genetic mutation. As a result, the salt and water balance is disrupted, leading to the production of thick, sticky mucus that clogs the airways, digestive tract, and other ducts in the body.

To know more about cystic fibrosis, refer here:

https://brainly.com/question/31366825#

#SPJ11

I
rupe de estudiante utiliza un aparate para estudia
reaction quimica entre pedande cascara de bo
acetico, me muestra la siguiente ilustracion
ar la transferencia de energia durante la
de camara de hormierhonate de calcio vare
Experimento con vinagre y cáscara de huevo
Burbujas
Burbujas
Burbujas
de
Tubo
de
vidrio
Tubo
de
vidrio
vidno
Cáscara de
huevo
Vinagre
Cáscara de
huevo
Vinagre
3
Cáscara de
huevo
Vinagre
5%
Durante el experimento, utilizan la misma masa de cascara de huevo, pere varian la
concentración del vinagre.
A. Explica por yue la transferencia de energia no es la misma entre las tres pruebas del
experimente
B. Describe como se podria modificar el aparato para que pueda medir con MAYOR
EXACTITUD la transferencia de energia en cada reacción.
Recuerda contestar todas las partes de la pregunta en el espacio previsto​

Answers

A. La transferencia de energía no es la misma entre las tres pruebas del experimento debido a la variación en la concentración de vinagre.

La concentración del vinagre influye en la velocidad y la eficacia de la reacción química. El vinagre es una solución diluida de ácido acético en agua, y el ácido actúa para disolver la capa externa de carbonato de calcio que compone la cáscara del huevo. Cuanto mayor sea la concentración de ácido acético en el vinagre, más rápida será la reacción y mayor será la transferencia de energía. Por lo tanto, se puede observar que la prueba que utilizó la concentración de vinagre al 10% tuvo una transferencia de energía mucho más alta que las otras dos pruebas.B.

El aparato se puede modificar para medir con mayor exactitud la transferencia de energía en cada reacción. Esto se puede hacer utilizando un calorímetro, que es un dispositivo que se utiliza para medir el calor de las reacciones químicas o los cambios físicos. El calorímetro consta de un recipiente aislado que contiene una muestra y se coloca en un baño de agua. Se mide la temperatura del agua antes y después de la reacción, y la diferencia en la temperatura se utiliza para calcular la cantidad de calor absorbido o liberado por la muestra.

To know more about tres  visit:

https://brainly.com/question/1098271

#SPJ11

what might a zoologist notice about birds caged indoors if she were looking for clues that they follow a biological rhythm in natural settings?

Answers

A zoologist notice about birds caged indoors if she were looking for clues that they follow a biological rhythm in natural settings she would observe the birds' behavior closely to detect if they follow a circadian rhythm which is a biological process that occurs within a 24-hour cycle.

The zoologist might notice that the caged birds appear to be restless or sleepless, suggesting that they are uncomfortable or out of sync with their natural rhythms. This is because birds are diurnal animals and require sunlight for proper bodily functions. The zoologist might also observe that the caged birds become increasingly agitated or active during certain times of the day.  This would suggest that the birds are naturally active during those periods in the wild and have maintained this behavior in captivity, indicating a biological rhythm.

Furthermore, the zoologist may notice changes in the bird's behavior in response to changes in lighting, as light is a key regulator of biological rhythms. Birds require a certain amount of light exposure during the day to function properly, and the absence of natural light could disrupt their natural rhythms and cause adverse effects. In conclusion, if a zoologist were looking for clues that birds follow a biological rhythm in natural settings, she might observe changes in the birds' behavior in response to light, as well as changes in activity levels at certain times of the day.

To know more about circadian rhythm visit:

https://brainly.com/question/31022861

#SPJ11

which of the following would not be a teratogen? question 18 options: cigarettes lead rubella (german measles) steak

Answers

The following would not be a teratogen among cigarettes, lead, rubella (german measles), and steak is steak. Teratogens are substances that interfere with prenatal development and can lead to birth defects. Cigarettes, lead, and rubella are known teratogens that can cause significant harm to a developing fetus. However, steak is not a teratogen.

Cigarettes are a teratogen because they contain harmful chemicals that can cross the placenta and interfere with fetal development. These chemicals can increase the risk of low birth weight, premature birth, and birth defects such as cleft palate and heart defects.

Lead is also a teratogen because exposure to high levels of lead during pregnancy can lead to developmental delays, learning disabilities, and other cognitive impairments in children. Lead can be found in contaminated water, soil, and household items such as paint and dust.

Rubella, or German measles, is another teratogen that can cause severe birth defects if a woman becomes infected during pregnancy. Rubella can cause deafness, blindness, heart defects, and intellectual disability in a developing fetus.

Steak, on the other hand, is not a teratogen. While some types of food, such as undercooked meat and raw eggs, can be harmful during pregnancy due to the risk of foodborne illness, properly cooked steak is not a teratogen and does not pose a risk to fetal development.

know more about Teratogens click here:

https://brainly.com/question/28815393

#SPJ11

Describe how Mendel performed his pea plant experiments.

Answers

Answer:

Every offspring does not look alike they change with the generations

Explanation:

Why do some organisms produce many more offspring than other organisms?

Answers

some animals have multiple offspring , like fish and turtles , in hopes that at least some of them will survive. These organisms that have large amount of offspring usually dont give extensive or any care in raising the offspring. They just hope that at least a couple survive to pass on their genes.
Organisms that only have a few offspring (ei monkeys, birds, humans, mammals in general) usually devote a large amount of care into raising their offspring. Most often the mother and the father raise the offspring, and the offspring has a very high chance of survival.
Both of these mechanisms are just to ensure the passing of genes.
Hope that helped XD

Consider the relationship between UV exposure (e.g. UV exposure...
Consider the relationship between UV exposure (e.g. UV exposure time) and colony formation in trp1-289 yeast plated on SD medium. (1pt) Would you predict there to be a positive or negative relationship between UV exposure and colony formation (i.e. number of colonies) in trp1-289 yeast plated on SD medium. Why? (1pt) If you were to graph this relationship, which variable (i.e. number of trp1-289 colonies on SD medium or UV exposure time) would go on the x-axis and which would go on the y-axis? (1pt) Explain why this relationship might not be linear? (Hint: use the information you generated in Q3&4 above). Include a description of what this relationship might look like?

Answers

The relationship between UV exposure and colony formation is negative.

There is a negative relationship between UV exposure and colony formation in trp1-289 yeast plated on the SD medium. This is because UV exposure can cause DNA damage, which can lead to decreased viability and colony formation in yeast.

The UV exposure time would be placed on the x-axis, representing the independent variable. The number of trp1-289 colonies on the SD medium would be placed on the y-axis, representing the dependent variable.

The relationship between UV exposure and colony formation might not be linear due to several factors. The relationship might exhibit a sigmoidal or exponential decay curve.

Learn more UV exposure, here:

https://brainly.com/question/29289143

#SPJ4

4. The diagram below represents one possible immune response that can occur in the human body.
**The structures that are part of the immune system are represented by
A, only
A and C, only
B and C, only
A, B, and C

5. Explain your answer to the previous question

Answers

Answer:

A and C only

Explanation:

I'm sorry I don't know how to explain it but trust me its A and C only.

Match each statement in the left column with the most likely characteristic in the light column. On June 21st. ✓[Choose] 34 degrees the declination of the Sun is 3 degrees north On March 20/2020 is the longest day of the year in the Southern Hemisphere it is the longest day of the year in the Northern Hemisphere On On January 10th, on the Equator, the Solar Altitude is northernmost latitude where the sun rays strike the Earth's surface perpendicularly... 54 degrees the day and night were 12 hours long anywhere between 0 and 60 degrees latitude in both hemispheres 67 degrees N On March 29th 68 degrees farthest distance from the Pole where the sun rays are tangent to Earth's surface. On July 3rd, the latitude of the tangent rays of the Sun is [Choose] On December 20th [Choose] The Tropic of Cancer (23.5 degrees N) is the [Choose] The Antarctic Polar Circle (66.5 degrees 5) is the [Choose ] On January 30th, the solar altitude in Central [Choose] California (about 38 degrees N), is: On April 22nd, the solar altitude in Seattle (about 48 degrees north) is: [Choose]

Answers

On June 21st: The declination of the Sun is 23.5 degrees north.

On March 20/2020: It is the longest day of the year in the Northern Hemisphere.

On January 10th, on the Equator: The Solar Altitude is 90 degrees.

On March 29th: The day and night are 12 hours long anywhere between 0 and 60 degrees latitude in both hemispheres.

On July 3rd: The latitude of the tangent rays of the Sun is 23.5 degrees north.

On December 20th: The Tropic of Capricorn (23.5 degrees south) is the farthest distance from the Pole where the sun rays are tangent to Earth's surface.

On January 30th, the solar altitude in Central California (about 38 degrees N): [Choose]

On April 22nd, the solar altitude in Seattle (about 48 degrees north): [Choose]

Explanation to the above short given answers are written below,

On June 21st, the declination of the Sun is 23.5 degrees north. This means that the Sun is at its highest point in the sky in the Northern Hemisphere, marking the summer solstice.

On March 20th (or around that date), it is the longest day of the year in the Northern Hemisphere. This is the vernal equinox, when the Sun is directly over the Equator and day and night are approximately equal in length.

On January 10th, on the Equator, the Solar Altitude is 90 degrees. This means that the Sun is directly overhead at noon, resulting in a vertical angle of 90 degrees between the Sun and the observer on the Equator.

On March 29th, the day and night are approximately 12 hours long anywhere between 0 and 60 degrees latitude in both hemispheres. This is around the time of the equinoxes when the length of day and night is equal.

On July 3rd, the latitude of the tangent rays of the Sun is 23.5 degrees north. This corresponds to the Tropic of Cancer, the northernmost latitude where the Sun's rays strike the Earth's surface perpendicularly.

On December 20th, the Tropic of Capricorn (23.5 degrees south) is the farthest distance from the Pole where the sun rays are tangent to Earth's surface. This marks the summer solstice in the Southern Hemisphere.

The solar altitude in Central California on January 30th and the solar altitude in Seattle on April 22nd are not provided, so the answers for these statements are missing.

To know more about "Summer solstice" refer here:

https://brainly.com/question/4172420#

#SPJ11

1. Explain why the greenhouse effect is necessary but how an enhanced greenhouse effect can harm the planet.
2. Define global warming and explain what has caused the recent trend of warming that the earth is experiencing.
3. Explain why Earth's temperature is directly affected by the amount of greenhouse gases in the atmosphere.
4. Define carbon sequestration and explain how deep geologic burial of carbon works.
5 Describe the connection between fossil fuel burning, the melting of polar ice, and the rising of global sea levels.

Answers

Answer:

1. The enhanced greenhouse effect disrupts the Earth's climate equilibrium and has led to an increase in the global average surface temperatures.

2. Scientists attribute the global warming trend observed since the mid-20th century to the human expansion of the "greenhouse effect"   1 — warming that results when the atmosphere traps heat radiating from Earth toward space. Certain gases in the atmosphere block heat from escaping.

3. Greenhouse gases absorb some of the energy and trap it in the lower atmosphere. Less heat radiates into space, and Earth is warmer. ... Carbon dioxide, methane, water vapor, and nitrous oxide are naturally present in Earth's atmosphere.

4. Carbon sequestration is the process of capturing and storing atmospheric carbon dioxide. It is one method of reducing the amount of carbon dioxide in the atmosphere with the goal of reducing global climate change.

5. As climate change caused by burning fossil fuels drives temperatures higher, the ocean warms, causing it to expand. ... Scientists have found that water draining from melting glaciers and ice sheets in polar and mountain regions is now also contributing to this rise in sea levels.

Answer: 1. Necessary because it keeps heat in and keeps the planet at the right temperature for life.

It can harm the planet if more pollution occurs and the greenhouse gas effect traps too much heat and causes global warming. 2. Scientists attribute the global warming trend observed since the mid-20th century to the human expansion of the "greenhouse effect"1 — warming that results Greenhouse gases let the sun's light shine onto the Earth's surface, but they trap the heat that reflects back up into the atmosphere. In this way, they act like the insulating glass walls of a greenhouse. The greenhouse effect keeps Earth's climate comfortable when the atmosphere traps heat radiating from Earth toward space. Certain gases in the atmosphere block heat from escaping. 3. Human activities contribute to global warming by increasing the greenhouse effect. ... Greenhouse gases let the sun's light shine onto the Earth's surface, but they trap the heat that reflects back up into the atmosphere. In this way, they act like the insulating glass walls of a greenhouse. 4. Carbon sequestration is the process of capturing and storing atmospheric carbon dioxide. It is one method of reducing the amount of carbon dioxide in the atmosphere with the goal of reducing global climate change. Geologic carbon sequestration is the process of storing carbon dioxide (CO2) in underground geologic formations. The CO2 is usually pressurized until it becomes a liquid, and then it is injected into porous rock formations in geologic basins. 5. As climate change caused by burning fossil fuels drives temperatures higher, the ocean warms, causing it to expand. This expansion in turn causes sea levels to rise. ... There is now so much warming baked in to the global climate system that sea levels will continue to rise for centuries.

Explanation:

Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]
5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3´

Answers

The correct mRNA sequence transcribed from the given DNA sequence is: 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' Here option B is the correct answer.

To determine the correct mRNA sequence transcribed from the given DNA sequence, we need to apply the rules of DNA transcription. During transcription, the DNA sequence is used as a template to synthesize an mRNA molecule, with the RNA base uracil (U) substituting for thymine (T) in the DNA.

The given DNA sequence is:

5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'

To transcribe this DNA sequence into mRNA, we replace each DNA base with its RNA counterpart:

G (Guanine) → C (Cytosine)

C (Cytosine) → G (Guanine)

A (Adenine) → U (Uracil)

T (Thymine) → A (Adenine)

Applying these conversions, we get the mRNA sequence:

5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'

Therefore, option b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' represents the correct mRNA sequence transcribed from the given DNA sequence.

To learn more about mRNA

https://brainly.com/question/29314591

#SPJ4

Complete question:

Which of the following represents the correct mRNA sequence transcribed from the given DNA sequence?

a) 5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'

b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'

c) 5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'

d) 5' GGGATCGATGCCCCTTAAAGAGUUUACAUUAUUGCUGGAGGCGUUAACCCCGGA 3'

write the two functions of blood?​

Answers

Explanation:

regulating body temperature

forming blood clots to prevent excess blood loss

What do tornadoes and hurricanes have in common

Answers

☁️ Answer ☁️

"Tornadoes and hurricanes appear to be similar in their general structure. Both are characterized by extremely strong horizontal winds swirling around the center, strong upward motion dominating the circulation with some downward motion in the center. "

1. Death

2. strong horizontal winds swirling around the center

3strong upward motion dominating the circulation with some downward motion in the center.

Hope it helps.

Have a nice day noona/hyung.




bynummeeks24

10/08/2020

BiologyHigh School

answered

Which of the following best describes how a channel protein moves materials across the membrane? A)They provide a carrier for specific molecules to bind to and cross the membrane via endocytosis. B)They provide a passage for specific molecules to cross the membrane via passive transport. C) They provide a tunnel for solutes to cross the membrane via active transport. D) They provide energy needed for solutes to cross the membrane via facilitated diffusion.

Answers

The correct option that best describes how a channel protein moves materials across the membrane is B) They provide a passage for specific molecules to cross the membrane via passive transport.

Channel proteins are integral membrane proteins that form channels or pores in the cell membrane. These channels allow the passive transport of specific molecules or ions across the membrane down their concentration gradient. This process is called facilitated diffusion, where the molecules move from an area of higher concentration to an area of lower concentration without the need for energy input. The channel proteins provide a selective passage for these molecules, enabling their movement across the membrane.

Therefore, the correct answer is B) They provide a passage for specific molecules to cross the membrane via passive transport.

For more details regarding passive transport, visit:

https://brainly.com/question/29764225

#SPJ4

Of the three major types of handwriting characteristics line form includes, smoothness of the lines,
pen pressure, and slant
True or False?

Answers

answer: true

explanation:

The Earth rotates counterclockwise on its axis. Because of this, in which direction does the Moon appear to move across the sky?

A. from north to south

B. from south to north

C. from west to east

D. from east to west

Answers

Answer:

East To West

Explanation:

What is the difference between a) prokaryote and eukaryote; b) autotroph and heterotroph; c) unicellular and multicellular?

Answers

Answer:

Explanation:

a) eukaryotes have membrane bound organelles like nuclei while prokaryotes don't

b) autotrophs = producers that can make their own food while heterotrophs consume producers or other consumers

c) Unicellular organisms are made up of only one cell that carries out all of the functions needed by the organism, while multicellular organisms use many different cells to function

What is one disadvantage of desalination?

The process can ultilize solar energy to lower its cost.
The process uses fuel that is expensive.
The process makes water that is unsafe to drink.
The process is too difficult to carry out in big cities.

Answers

Answer:

B

Explanation:

Desalination remains expensive, as it requires enormous amounts of energy. The correct answer is b) The process uses fuel that is expensive.

What is desalination?

Saline water which is typically sea water, is artificially transformed into fresh water through a process called desalination. Reverse osmosis and distillation are the two most used desalination techniques. There are several approaches. Although each has benefits and drawbacks, they are all useful.

The issue is that it takes a lot of energy to desalinate water. When salt is dissolved in water, it forms strong chemical bonds that are challenging to break. Desalinating water may be rather expensive since both the energy and the technology required are costly.

Desalination turns seawater into freshwater by removing the salt, however, it also has certain unfavorable effects on the ecosystem. Desalination facilities release trash and poisonous chemicals that are bad for the environment and animals. The procedure can also increase the salinity of saltwater, which has an impact on fish.

Therefore, the correct answer is b).

For more details regarding desalination, visit:

https://brainly.com/question/19537065

#SPJ5

What can adults do to shrink fat cells?

Answers

Answer: To shrink fat cells, you need to eat fewer calories than your body needs.

CREDIT: healthyeating

Answer:

eat healthily and exercise properly

Explanation:

Explain the difference between DNA, chromosomes, genes, and the protein that is created.

I NEED THIS QUICKLY PLS!!!

Answers

DNA contains the instructions, genes, to make proteins that tell what genetic traits the person will have. The DNA along with the proteins make up the chromosomes. The chromosomes are then passed on to the offspring, and with the DNA inside the chromosomes and translation of the genes, its traits are decided. Genes are made up of strains of proteins called amino acids

Explanation:

DNA is a long molecule that contains our unique genetic code.DNA is composed of two strands that wrap around each other to form a double helix shape.

Genes are sections of DNA that contain the set of instructions to produce one specific molecule in your body, usually a protein. These proteins control how our body grows and works; they are also responsible for many of our characteristics, such as our eye colour, blood type or height.

Chromosomes are bundles of tightly coiled DNA located within the nucleus of almost every cell in our body. Humans have 46 chromosomes . We inherit one set of 23 chromosomes from our mother and one set of 23 chromosomes from our father. So we have two sets of 23 chromosomes or 23 pairs.

What allele pairs will result from this combination of alleles MmQq? ( use the 13,14,23,24 strategy).
A). All of these are correct
B). MQ, Mq, mQ, mq
C). Mq, mQ, mq, Mq
D). MM, mm, QQ, qq

Answers

The answer is B). MQ, mQ, Mq, mq

 HURRY I HAVE A TIME LIMIT!

Humans, cats, whales, and bats all have similar arm bones. What piece of evidence for common ancestry does this describe?

-homology
-embryology
-fossil record
-amino acids sequences

Answers

Answer: that they all have the bones used to make their movements so they can live and survive on there own.

Explanation:

Light traveling through the air moves in a straight line. An object viewed through water looks different because light rays that travel through water are . . .
A.bent
B.reflected
C.bounced
B.absorbed

Answers

I think The correct answer is c
the answers B , reflected

Beneficial bacteria are found in our digestive tract

A. true
B. False

please help

I will give brainliest and 5 * and 10 points for the best answer

I don't want to see an link if I do you will be reported

Answers

(A), because there are bacteria your body don’t attack because they are helpful.
Other Questions
what's a best practice to follow when designing an experiment to test performance max campaigns? keep performance max budget limited to 10% of other campaigns' budgets. optimize performance max to a comparable cpa or roas target to other campaigns. create a new cpa or roas goal for performance max campaigns to achieve. run the performance max experiment for one to two weeks before evaluating results. Describe how Mendel performed his pea plant experiments. assume that this is a competitive market, what will happen to the market selling price and the market quantity that is bought and sold in the market for "good x" OKAY SO I NEED HELP BC I HAVE TO GO TO THE GYM BUT THIS IS DUE BEFORE I GET BACK please someone help me out, please don't put the incorrect answerWhat is the distance between the points (-1, 2) and (2, 6)? Which of the following is not true of the things you should do before youinterview someone?O A. You should prepare a list of questions in advance.B. You should know what you want to learn from the subject.O c. You should prepare a series of open-ended questions.O D. You should prepare a series of close-ended questions. Imagine that you are a film director, and you want to make a short movie of "The Moment. " How would you express what the poem means to you and how might you try to present it on film. Would you use symbolism to express the theme? Would you title your film "The Moment," or would you choose a different title? Describe yourfilm and explain how it represents the meaning of the poem NASA or National Aeronautics and Space Administration was created in the United States to help the US be the first to place an astronaut on the moon.Question 4 options: True False Read the excerpt from "Code Talkers.Although American Indian soldiers had effectively used their languages to create and transmit secret messages during World War I, military leaders were reluctant to use the code a second time, fearing that it would no longer be effective. The Japanese and German governments had sent students to the United States specifically to learn certain American Indian languages. The Navajo language, however, was so complex that few people outside the Navajo Nation itself could speak it. In 1942, it was estimated that only thirty non-Navajos spoke the language worldwide.Which questions would improve the readers ability to understand the military leaders fear that the code would no longer be effective? Select 2 options.How many people spoke Navajo before World War I?Was the US government able to figure out other countries codes?Why did the Navajos try to prevent outsiders from learning their language?Did any of the Japanese or German students learn to speak Navajo?What kind of code did the American Indians use during World War I? you have a collection of six 2.3 kk resistors. part a what is the smallest resistance you can make by combining them? Express your answer with the appropriate units. Which of the following functions in R will allow you to implement a form of regularization?a) lm()b) glm()c) lm.ridge()d) all of the above Identify two possible reasons for unemployment Can someone explain why the answer is False. Will Mark brainliest. Write all of the words in the correct order. trouble / lie / people / to avoid 1 POINT Enter Answer Here Vedica (V) has the following utility function of wealth: = y 4/3 Vedica is a potential international immigrant to the United States. She works out that she faces the following lottery if she tries to travel to the US to work or to become a student. She starts with wealth of $20 000. She is told that if she goes to the US, she could end up gaining additional wealth of $100 000 with probability (p) and that she could lose all of her $20 000 with probability (1 p). Vedica believes that she will be successful with a probability of 10%. Read the following statement. Do you think the statement is true or false? Explain your answer mathematically and intuitively. As a member of the government of the state from which Vedica originates, you evaluate Vedicas case and work out that Vedica is risk-loving and you would need to compensate Vedica the equivalent of approximately $1340 for her to remain in your country and not emigrate A payment of $970 scheduled to be paid today and a second payment of $1,260 to be paid in seven months from today are to be replaced by a single equivalent payment. What total payment made today would place the payee in the same financial position as the scheduled payments if money can earn 6.25%? (Do not round intermediate calculations and round your final answer to 2 decimal places.) Which of the graphs below represents the soltuion set for d - 4 > -3? a. What side of the T-Account is titled debit? (5 pts) b. What side of the T-Account is titled credit? (5 pts) c. What are the 5 primary accounts (elements) in Accounting? (5 pts) d. What accounts are reported on the Balance Sheet? (5 pts) e. What accounts are reported on the Income Statement? (5 pts) f. List the normal balance side for the 5 primary accounts. (5 pts) g. List what side of the 5 primary accounts balances increase on? (10 pts) h. List what side of the 5 primary accounts decrease on? (10 pts), The fact that online games are so popular is probably proof that:A. all games are evil.B. all games are valuable parts of our lives.C. games have a large influence in the networked world.D. everyone should be gaming. I've done everything I can, please help