W Krakowie średnia temperatura powietrza w najcieplejszym miesiącu wynosi 17 i pół stopnia a w najzimniejszym minus 3,3 stopni Oblicz różnicę temperatury powietrza między najcieplejszym a najzimniejszym miesiącem w roku (średnią roczną amplitudę temperatury powietrza).

Answers

Answer 1

Answer:

14.2

Explanation:

Aby obliczyć ten problem, musimy najpierw wziąć 3.3 i odjąć je od 17 i pół (17.5). kiedy to robimy, otrzymujemy 14.2

17.5 - 3.3 = 14.2

mam nadzieję, że to pomoże i życzę miłego dnia! :)


Related Questions

What are the physical characteristics of sedimentary, metamorphic, and indigenous rocks? And some examples please.​

Answers

Answer: The three types of rocks

Igneous — they form from the cooling of magma deep inside the earth. ...

Metamorphic — they are formed through the change (metamorphosis) of igneous and sedimentary rocks. ...

Sedimentary — they are formed through the solidification of sediment.

Sedimentary Features

Bedding. Bedding is often the most obvious feature of a sedimentary rock and consists of lines called bedding planes, which mark the boundaries of different layers of sediment. ...

Graded beds are common when a sediment is being deposited by a slow‐moving current. ...

Fossils. ...

Desiccation cracks and ripple marks.

Explanation:

i hope this is what you were looking for <3

What symbols and colors stand for on the map?

Answers

Answer: Physical maps use color most dramatically to show changes in elevation. A palette of greens often displays elevations. Dark green usually represents low-lying land, with lighter shades of green used for higher elevations. In the next higher elevations, physical maps often use a palette of light brown to dark brown.

Chinese Traditional Cosmology may be viewed as obsolete & even wrong by modern scientific standards. Nevertheless, why is it considered valuable by most Chinese, Koreans, Japanese, Vietnamese, and Southeast Asians?

Answers

Chinese Traditional Cosmology is considered valuable by most Chinese, Koreans, Japanese, Vietnamese, and Southeast Asians due to its cultural significance, historical importance, and its influence on various aspects of their societies.

1. Cultural Significance: Chinese Traditional Cosmology is deeply rooted in the cultural heritage of these East Asian countries. It is intertwined with their religious beliefs, philosophy, art, literature, and traditional practices. It provides a framework for understanding the universe and one's place within it, shaping the way people perceive and interact with the world.

2. Historical Importance: Chinese Traditional Cosmology has a long history dating back thousands of years. It has played a significant role in shaping the civilizations and societies of these regions. It has been passed down through generations and has become an integral part of their identity and sense of heritage. It carries the wisdom and knowledge of their ancestors, providing a connection to their historical roots.

3. Influence on Various Aspects of Society: Chinese Traditional Cosmology has influenced various aspects of life in these countries. It has influenced architecture, urban planning, traditional medicine, astrology, feng shui (the arrangement of objects and spaces in harmony with the environment), and even decision-making in governance. It has provided guidance on matters such as auspicious dates for important events, the design of buildings for harmonious energy flow, and the understanding of the natural world.

4. Spiritual and Philosophical Insights: Chinese Traditional Cosmology offers spiritual and philosophical insights that resonate with many people in these cultures. It provides a holistic view of the universe, emphasizing the interconnectedness of all things and the balance between opposing forces. It explores concepts such as yin and yang, the Five Elements, and the harmony between humans and nature. These concepts provide guidance for leading a balanced and fulfilling life and have enduring appeal for individuals seeking spiritual and philosophical wisdom.

Despite the advancements of modern science, Chinese Traditional Cosmology continues to hold value as a cultural and historical heritage. It serves as a source of inspiration, identity, and a lens through which individuals and communities interpret the world around them. Its enduring significance lies in its ability to provide a unique perspective on the human experience and offer insights into the relationship between humans, nature, and the cosmos.

To know more about Cosmology click here:

https://brainly.com/question/31857986

#SPJ11

Several years ago a life-cycle analysis attempted to answer the question of whether cloth diapers are more environmentally friendly than disposable diapers. The analysis found that disposable diapers required more raw materials to make and were responsible for far more solid waste than the reusable cloth diapers. However, total use of energy and water, as well as emissions of air and water pollutants, were significantly higher for the cloth diapers compared to the disposable product. Describe the life-cycle factor that you think is most likely responsible for the higher water and energy use associated with cloth diapers.

Answers

The life-cycle factor that is most likely responsible for the higher water and energy use associated with cloth diapers is laundering.

According to the analysis, disposable diapers are responsible for more solid waste than reusable cloth diapers and require more raw materials to make.

However, it was discovered that cloth diapers use significantly more energy and water as well as produce more air and water pollutants during the life cycle compared to disposable diapers.The life-cycle factor that is most likely responsible for the higher water and energy use associated with cloth diapers is laundering.

Cloth diapers require frequent washing to remove any waste and bacteria. This means that they need to be washed with hot water and detergent to get them clean. The frequent washing of cloth diapers uses a lot of energy and water. On the other hand, disposable diapers are used once and thrown away. Hence, there is no need to wash or use water for cleaning purposes.

to know more about pollutants, visit

https://brainly.com/question/29594757

#SPJ11

Given the observed average distance between galaxies today, which statement is true?

The faster the past expansion rate, the younger the age of the universe.
The faster the past expansion rate, the older the age of the universe.
The age of the universe depends only on the average distance between galaxies, not on the rate of expansion.

Answers

The statement that is true given the observed average distance between galaxies today is that the faster the past expansion rate, the younger the age of the universe. Option a is correct.

According to Hubble's Law, the speed of galaxies receding from us is proportional to their distance from us. Hence, a faster past expansion rate implies that the galaxies were closer together in the past.

If we run the clock backwards and extrapolate from the observed rate of expansion, we find that the universe must have been hotter and denser in the past. This ultimately means that the age of the universe is younger, since it has taken less time for the universe to expand from its past density and temperature to its current state.

Therefore, a is correct.

Learn more about galaxies https://brainly.com/question/11948445

#SPJ11

which business custom do the mint countries of mexico, indonesia, nigeria, and turkey all have in common?

Answers

The business custom that the mint countries of Mexico, Indonesia, Nigeria, and Turkey have in common is the practice of high inflation rates.

The term "mint countries" refers to a group of emerging economies with rapidly growing populations and economies. While there may be various similarities among these countries, one notable commonality is their struggle with high inflation rates. Inflation refers to the general increase in prices of goods and services over time, reducing the purchasing power of a currency.

High inflation rates can have significant implications for businesses, such as increased production costs, uncertain pricing, and reduced consumer purchasing power. These countries may share a history of economic instability, monetary challenges, and efforts to manage and control inflation to foster a more stable business environment.

To know more about custom, click here.

https://brainly.com/question/13472502

#SPJ4

Which of the following conclusions can they draw based on the information
available?
Earth's mass is less than each of the inner planets.
Earth has a higher density than each of the gas giants.
Earth's size is larger than Mercury but smaller than Mars.
O Earth is closer in distance from the Sun than Venus but further than Jupiter.

Answers

Answer:b

Explanation:

In recent years, the war on drugs has centered on the border between Mexico and the United States. Which of the following statements about this war is false?
A.
The amount of violence has been decreasing, so few people have been killed.
B.
The United States spends more than $500 million a year to fight the cartels.
C.
Most of the violence occurs near the US-Mexican border.
D.
Most police officers are dedicated to ending the drug smuggling.

Please select the best answer from the choices provided
A
B
C
D

Answers

Answer: The amount of violence has been decreasing, so fewer people have been killed.

Explanation: That is false.

Answer:

the answer is A lol

Explanation:

1) The P-wave from the March 11 9.0 magnitude Japan earthquake first arrived in Honolulu, Hawaii, 9 minutes and 19.7 seconds after the earthquake occurred. This is equal to 0.155 hours. Honolulu, Hawail, is 3715. 35 miles from the epicenter of this 9.0 magnitude earthquake How fast, in miles per hour, did the P-wave generated by this earthquake travel between Japan and Honolulu? Show your work 2) The tsunami that was generated by this March 11" earthquake took approximately 7.35 hours to reach Hawaii. The distance between the epicenter of the earthquake and the Hawaiian islands that first experienced the tsunami waves is approximately 3466 miles. How fast was the tsunami wave moving in miles per hour when it arrived in Hawaii? Show your work. 3) The height of the tsunami was "10 meters (32 feet) in Japan. It was only 0.9 to 1.2 meters (3 to 4 feet) on average when the tsunami reached Hawail. The destruction from the tsunami in Japan was devastating, while it was much less severe in Hawai. Why do you think the size of the tsunami changed so much between these two locations?

Answers

1) To calculate the speed of the P-wave between Japan and Honolulu, we need to use the formula:

speed = distance/time.

Given:

- Time: 0.155 hours

- Distance: 3715.35 miles

Using the formula, we can calculate the speed:

Speed = 3715.35 miles / 0.155 hours ≈ 23971.61 miles per hour

Therefore, the P-wave generated by the earthquake traveled at approximately 23971.61 miles per hour between Japan and Honolulu.

2) To calculate the speed of the tsunami wave, we use the same formula: speed = distance/time.

Given:

- Time: 7.35 hours

- Distance: 3466 miles

Using the formula, we can calculate the speed:

Speed = 3466 miles / 7.35 hours ≈ 471.38 miles per hour

Therefore, the tsunami wave was moving at approximately 471.38 miles per hour when it arrived in Hawaii.

3) A. The size of the tsunami changed significantly between Japan and Hawaii due to several factors.

Here is the explanation:

The main reason for the significant change in the size of the tsunami between Japan and Hawaii is the distance traveled and the ocean floor's topography. When the tsunami is generated, it propagates outward in all directions from the epicenter. As it travels across the ocean, it gradually loses energy and dissipates. The longer the distance it travels, the more power it loses.

In the case of the Japan earthquake, the epicenter was relatively close to the coast, and the tsunami had less distance to travel before reaching the shores. This allowed the tsunami to retain much of its initial energy and height. As a result, the tsunami in Japan reached a height of 10 meters (32 feet).

On the other hand, Hawaii is located thousands of miles away from the earthquake's epicenter. During its journey across the Pacific Ocean, the tsunami encounters various factors that cause energy dissipation, such as friction with the ocean floor and dispersion due to the spreading of the wavefront. These factors gradually reduce the height and power of the tsunami. By the time it reached Hawaii, the tsunami had traveled a long distance and lost a significant amount of energy, resulting in an average height of only 0.9 to 1.2 meters (3 to 4 feet).

Additionally, the topography of the ocean floor plays a role in the change in tsunami size. The shape and depth of the ocean floor in the path of the tsunami can affect its behavior. In the case of the Japan tsunami, the ocean floor near the coast had a steep incline, which allowed the wave to build up and amplify its height. In contrast, the ocean floor in the Pacific Ocean between Japan and Hawaii is much deeper and has a gentler slope. This causes the tsunami wave to spread out and lose height as it travels, resulting in a diminished impact when it reaches Hawaii.

Overall, the combination of distance traveled and the characteristics of the ocean floor contribute to the significant difference in the size of the tsunami between Japan and Hawaii.

To know more about P-wave click here:

https://brainly.com/question/26489416

#SPJ11

14. The United Nations Sustainable Development
Goals do not mention population growth, but
most of the goals will affect population growth
Which of the following statements correctly
explains a link between the Sustainable
Development Goals and population growth?
(A) Reducing infant mortality rates can lead to
a desire to have a smaller family.
(B) Reducing poverty and hunger increases
population growth as it makes larger
families possible
(C) Gender equality and empowering women
leads to fewer women in the paid labor
force.
(D) Combating communicable diseases and
improving maternal health means more
potential mothers survive and have
additional children
(E) Economic development strategies make it
possible to support larger families.
ation

Answers

Answer: D) Combating communicable diseases and

improving maternal health means more

potential mothers survive and have

additional children

The statements that correctly explains a link between the Sustainable Development Goals and population growth include:

B. Reducing poverty and hunger increases population growth as it makes larger families possible.

D. Combating communicable diseases and improving maternal health means more potential mothers survive and have additional children.

E. Economic development strategies make it possible to support larger families.

The Sustainable Development Goals (SDGs), were put in place by the United Nations in order to protect the world, end poverty, and ensure that peace and prosperity is enjoyed by the people.

It should be noted that when poverty is reduced, this will aid population growth, and tackling diseases will lead to lesser deaths and increase in population.

In conclusion, the correct options are B, D and E.

Read related link on:

https://brainly.com/question/19956954

organize your data from all previous sections. summarize volcano type/composition relationships.

Answers

Volcano type and composition are closely linked, as the type of volcanic activity and eruption style is influenced by the composition of the magma within the volcano.

A volcano is a geological feature that occurs when molten rock, ash, and gases escape from beneath the Earth's surface. It is a vent or opening in the Earth's crust through which this material erupts, forming a cone-like mountain or hill. Volcanoes can be found on land and underwater, and they are typically associated with areas of intense tectonic activity, such as subduction zones and mid-ocean ridges.

When a volcano erupts, it can release a variety of materials, including lava, which is the molten rock that flows out of the volcano, and pyroclastic materials, such as ash, rock fragments, and gases, which are violently ejected into the atmosphere. Volcanic eruptions can vary in intensity, ranging from relatively gentle effusive eruptions to explosive eruptions that can cause significant destruction.

To know more about Volcano refer to-

brainly.com/question/31604202

#SPJ4

Determining the Ages of Ocean Basins km The following procedure will allow you to calculate the age of a portion of the North Atlantic and South Atlantic basins. 1. Using Figure 2, measure the distance from Point A located off the Carolina coast to Point B off the African coast. Determine the distance in kilometers and then convert that distance into centimeters. continued Activity 6C continued Distance: km Distance: cm 2. Divide the distance in centimeters separating the continents obtained in Question 1 spreading for the North Atlantic basin that you calculated in Question 1 in Activity 6B. Your answer continents obtained in Question 1 by the rate of seafloor approximate age, in years, of the North Atlantic basin at that location. Distance/Rate of seafloor spreading = _ Age of the North Atlantic basin: - years 3. Repeat the procedure above to determine the age of the South Atlantic basin from Point Calong the eastern edge of Brazil to Point D off the coast of Africa. How many years ago did South America and Africa begin to separate at that location? Age of the South Atlantic basin: years 4. Based on your answers to Questions 2 and 3, which part of the Atlantic basin appears to have opened first?

Answers

Answer:

Based on the given information, the procedure allows you to calculate the age of a portion of the North Atlantic and South Atlantic basins. Unfortunately, the text you provided seems to be incomplete and some crucial details are missing, making it difficult to provide accurate answers to the questions. The missing information includes the measurements of the distance between Point A and Point B, the rate of seafloor spreading, and the distance between Point C and Point D.

To accurately determine the age of the North Atlantic and South Atlantic basins and identify which part opened first, the missing measurements and data are necessary. Please provide the complete information, and I'll be happy to assist you further.

Based on the given information, we can determine the age of the North Atlantic and South Atlantic basins using the provided procedure. Here are the answers to the questions:

1. Measure the distance from Point A to Point B:

  - Distance: [insert measured distance in kilometers]

  - Distance: [insert converted distance in centimeters]

2. Divide the distance in centimeters by the rate of seafloor spreading:

  - Age of the North Atlantic basin: Distance/Rate of seafloor spreading = [calculate and insert the approximate age in years]

3. Repeat the procedure for the South Atlantic basin from Point C to Point D:

  - Age of the South Atlantic basin: [calculate and insert the approximate age in years]

4. Based on the answers to Questions 2 and 3, determine which part of the Atlantic basin opened first:

  - Compare the ages of the North Atlantic and South Atlantic basins. The part with the earlier age is the one that opened first.

Please note that the specific measurements and calculations are not provided in the question, so the numerical values cannot be determined. However, by following the procedure and performing the necessary measurements and calculations, you can determine the ages and compare which part of the Atlantic basin opened first.

To learn more about South Atlantic basins, click here:

https://brainly.com/question/14346137

#SPJ11

Need help on this question asap pleasee

Answers

Answer:

en español porfa no entiendo el ingles

The geological theory that states that pieces of earths lithosphere are in constant, slow motion is the theory of

Answers

Answer:

plate tectonics

Explanation:

plate tectonics the theory that pieces of Earth's lithosphere are in constant motion, driven by convection currents in the mantle.

I'm sorry if the answer wrong xd

Answer:

Plate Tectonics

Explanation:

The theory that pieces of Earth's lithosphere are in constant motion, driven by convection currents in the mantle.

Jen's commute to work requires that she take the blue subway line.
a. True
b. False

Answers

The statement Jen's commute to work requires that she take the blue subway line is: a. True

What is commute?

The statement  means that Jen must take the blue subway line in order to get to her destination. The redline is only used for transferring to another line.

So,

Jen's commute to work requires that she take the blue subway line.The blue subway line is the only line that goes to Jen's destination.The redline is only used for transferring to another line.

Therefore the statement is true.

Learn more about commute here:https://brainly.com/question/30161611

#SPJ4

Question How have industrialization and urbanization changed China? Check all that apply. O A. They helped the migration from cities to rural areas. B. They turned China into a world economic power. I C. They transferred wealth to more people. D. They created more unhealthy and polluted conditions.

Answer; B C D​

Answers

Industrialization and urbanization changed China Option B. They turned China into a world economic power.

The industrialization and urbanization have brought many changes to China, affecting the lives of people in different ways.

These changes are mainly brought about by the rapid growth of cities and the emergence of industries.

Check all the ways through which industrialization and urbanization have changed China:They turned China into a world economic power:With the rise of industrialization and urbanization, China has become a world economic power.

The industrialization process has enabled China to produce a wide range of goods, including clothing, electronics, and machinery, which has increased the country's exports.

This has contributed to the growth of the economy, with China becoming the world's second-largest economy today.

The rapid urbanization process has also led to an increase in the number of urban dwellers, who have contributed to the growth of the country's economy by engaging in various activities, including business, trade, and manufacturing.

They transferred wealth to more people:With the growth of industries and the expansion of urban centers, more people have been able to access job opportunities.

This has led to the transfer of wealth to more people, improving their economic status.

The growth of industries has led to an increase in the number of people employed in the manufacturing and service sectors, and this has helped to increase their income levels.

This has also led to the growth of the middle class in China, which has contributed to the growth of the country's economy.

They created more unhealthy and polluted conditions:The rapid industrialization and urbanization have also brought with them various challenges, including environmental pollution and unhealthy conditions.

The growth of industries has led to an increase in air and water pollution, which has affected the health of people living in urban centers.

The rapid urbanization process has also led to the growth of slums and other informal settlements, which lack basic services such as water and sanitation.

These conditions have contributed to the spread of diseases, including respiratory diseases, cholera, and other illnesses.

In conclusion, the industrialization and urbanization of China have brought about significant changes to the country, affecting the lives of people in different ways.

The growth of industries has enabled China to become a world economic power, while the expansion of urban centers has led to the transfer of wealth to more people.

However, this growth has also led to environmental pollution and the spread of unhealthy conditions, affecting the health of people living in urban centers.

For more questions on Industrialization

https://brainly.com/question/867425

#SPJ8

which of the following is a finding of the biological dynamics of forest fragments project (bdffp)?
a. edge effects were common and led to increases in local species extintions
b. both a and c
c. the largest fragments maintained all of their previous species diversity
d. fragments of forests become isolate from one another at relatively small distances between fragments

Answers

The Biological Dynamics of Forest Fragments Project (BDFFP) was launched in 1979 to investigate the ecological changes caused by rapid deforestation.

The correct option is B.

The BDFFP's findings were numerous, and determined that edge effects were common and that local species extinctions increased due to edge effects, that fragment sizes below 500 hectares are highly vulnerable to conservation, and that the largest fragments raised by the study maintained their previous diversity of species.

Additionally, the BDFFP noted that fragmentation of forests could cause fragmented sites to be isolated from each other at relatively small settings between fragments, and suggested that fragment size thresholds are contingent upon the species that inhabit it.

The BDFFP ultimately revealed that deforestation and the fragmentation of the remaining forests have limited conservation potential. They noted that the impact of habitat fragmentation may be irreversible and called for greater protection of remaining forests in order to maintain both local species and globalspecies' diversity.

To know more about deforestation , click here:

https://brainly.com/question/17178423

#SPJ4

vija celmins uses the pacific ocean as subject matter because...

Answers

Vija Celmins uses the Pacific Ocean as subject matter because It parallels the immense scale of the image she creates.

Vija Celmins is renowned for her meticulous and intricate paintings and drawings, many of which feature the Pacific Ocean and other natural landscapes and objects. She has drawn inspiration from the ocean for a variety of reasons.

The Pacific Ocean's size and capacity to inspire awe and wonder are a few of the causes. Celmins is interested in delving into the idea of scale as well as the experience of coming face to face with something enormous and overwhelming. She can capture the Pacific Ocean's vastness and encourage viewers to think about their place within the larger natural world by using it as her subject.

Learn more about Vija Celmins at:

brainly.com/question/25547676

#SPJ4

What percentage of daughter isotope would exist in a sample containing 50 percent parent isotope?

Answers

The answer is 16
Because of your daughter

Which of the following statements about Southeast Asia is true? Southeast Asian countries are united by the fact that most of their populations are Sikh. Southeast Asia, although religiously plural, has not experienced any religious conflicts. Southeast Asia's religious plurality has led to many religious conflicts

Answers

Answer:

Southeast Asia's religious plurality has led to many religious conflicts

Explanation:

Southeast Asia is known for its religious diversity, with many different religious traditions. Islam, Buddhism, Christianity, Hinduism, and various indigenous religions are among them. While religious diversity has enriched Southeast Asia's cultural fabric, it has also been a source of tension and conflict throughout history.

In Southeast Asia, there have been several instances of religious conflict. For example, there have been periodic tensions and conflicts between different religious groups in Indonesia, which has the world's largest Muslim population. Religiously motivated violence has occurred in the country, such as inter-communal clashes between Muslims and Christians in the Maluku Islands and Sulawesi.

Long-standing conflicts exist in Myanmar (formerly Burma) between the Buddhist majority and ethnic minority groups, particularly the Rohingya Muslim population. The situation has resulted from human rights violations, displacement, and international concern.

Other religious conflicts in Southeast Asia include the southern Thailand insurgency, which includes Muslims seeking greater autonomy, and occasional tensions between Buddhists and Muslims in Thailand and Sri Lanka.

While religious conflicts do not define Southeast Asia, the region's religious plurality has sometimes contributed to tensions and disputes between different religious groups.

with whom did the ancient Chinese trade along the slik Roads?

Answers

With Rome. Silk Road was linking China with the West and it carried goods and ideas between the two great civilizations of Rome and China.

what is the source of most of the lava that flows down the hawaiian shield volcanoes?

Answers

Answer:

Most of the lava that flows down Hawaiian shield volcanoes comes from magma chambers located beneath the volcano.

Explanation:

Hope this helps :)

Mantle plumes are the source of the majority of the lava that flows down the Hawaiian shield volcanoes.

Mantle plumes are upwellings of hot, light material from profound inside the World's mantle. These crest start close to the center mantle limit and ascend through the mantle, at last arriving at the surface as volcanic action. On account of the Hawaiian safeguard volcanoes, the magma got from mantle plumes is known as basaltic magma. Basaltic magma has a low thickness and high temperature, permitting it to stream effectively and create liquid magma streams.

The Hawaiian Islands are situated over a fixed mantle crest known as the Hawaiian Problem area. As the Pacific structural plate moves over this fixed area of interest, progressive volcanic emissions happen, framing a chain of islands. The mantle plume underneath the area of interest consistently supplies basaltic magma to the volcanoes, bringing about the development of the safeguard volcanoes normal for Hawaii.

The magma created by the Hawaiian safeguard volcanoes is basically made out of basalt, a kind of volcanic stone wealthy in iron and magnesium. The low thickness of basaltic magma permits it to travel significant distances from the vent, bringing about the far and wide magma streams saw in Hawaii.

To learn more about Volcanoes,

https://brainly.com/question/30319768

from coldest to hottest in order what is it?
i. hII regions
ii. neutral hydrogen clouds
iii. ultra-hot insterstellar gas

Answers

In order from coldest to hottest, the ranking would be:

i. Neutral hydrogen clouds
ii. HII regions
iii. Ultra-hot interstellar gas

Which of the following are tied to Gerrymandering and/or to the Voting Right Act of 1965?

Passing literacy tests to vote

Governor Elbridge Gerry

Majority-Minority Districts

A struggle to empower minorities without gerrymandering

Poll Taxes

Aimed at voting power

Answers

Answer:

Passing literacy tests to vote

Explanation:

The first one should is actually against the law and against the Voting Act of 1965

Answer:

passing literacy tests to vote

Explanation:

B)

What is Imperialism and what are some examples?
Please explain thoroughly and don't plagiarize

Answers

Imperialism is described as the practice of a larger country or government becoming stronger by absorbing poorer or weaker countries with valuable resources. England's colonization of India was an example of imperialism.
Question:

What is Imperialism and what are some examples?

Answer:

Imperialism means creating an empire, expanding into the neighbouring regions and expanding its dominance far.

One of the most notable examples of American imperialism in this age was the annexation of Hawaii in 1898, which allowed the United States to gain possession and control of all ports, buildings, harbors, military equipment, and public property that had formally belonged to the Government of the Hawaiian Islands.The Conquistadors from Spain coming to the America To bring treasures, gold, resources back to Spain.

Hope it helps

-------☆゚.・。゚ᵴɒƙυᴚᴀ_ƨȶäᴎ❀

fitb. a vertical air pressure gradient is directed from the ______ to the ______.

Answers

Fitb: A vertical air  is directed from the lower altitudes to the higher altitudes.

As we ascend in the atmosphere, the air pressure gradually decreases due to the decreasing weight of the air column above.

This vertical pressure gradient is a result of the Earth's gravitational force acting on the air molecules. The higher we go in the atmosphere, the lower the air pressure becomes.

This vertical pressure gradient is an essential factor in atmospheric circulation and the formation of weather patterns. It influences the movement of air masses, the development of wind systems, and the distribution of temperature and moisture in the atmosphere.

To know more about pressure gradient refer to-

https://brainly.com/question/30463106

#SPJ11

How does the mass of star determine the temperature?

Answers

Answer:

Mass determines how hot the stellar core gets in response to gravitational contraction, and since the rate of nuclear burning is very sensitive to temperature, a star's mass determines the energy production rate and whether/when gravitational contraction can lead to explosive release of energy

Explanation:

What is the best description of the "10-year flood"?
- a flood that has a 10% chance of occurring each year
- a flood that occurred within the last 10 years
- a flood that can occur only once every 10 years
- a flood that lasts for approximately 10 years

Answers

The best description of the "10-year flood" is that it is a flood that has a 10% chance of occurring each year. This is known as the "return period" and it indicates the likelihood of the flood occurring in a given year.

A 10-year flood means that there is a 10% chance that a flood of that magnitude will occur in any given year.The term "10-year flood" can be a bit misleading as it doesn't necessarily mean that a flood of that magnitude will only occur once every 10 years. In fact, it's possible for a 10-year flood to occur two years in a row or even multiple times in a single year.

The term "10-year flood" is simply a way of describing the likelihood of a flood of that magnitude occurring in any given year.

The other options listed in the question are not accurate descriptions of a 10-year flood:

- A flood that occurred within the last 10 years: This has nothing to do with the likelihood of a flood occurring.

- A flood that can occur only once every 10 years: This is not accurate as a 10-year flood can occur multiple times within a 10-year period.

- A flood that lasts for approximately 10 years: This is not an accurate description of the frequency or magnitude of a flood.

To know more about magnitude, visit

https://brainly.com/question/31022175

#SPJ11

Which areas of India seem least affected by the monsoon? Most affected?

Answers

West part of India (Tamil Nadu, Jammu and Kashmir) are least affected by the monsoon. And Northeast India (The eastern Himalaya region, Darjeeling and Shillong) is most affected by the monsoon.

different works of river and different stages of river​

Answers

Answer:

oh why explain

plasssssasssssaaaaaaa

Other Questions
Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed why could one argue that the typical word superiority effect findings are counter intuitive We do solemnly and mutually in the presence of God, and one of another, covenant and combine ourselves together into a civil body politic, for our better ordering and preservation. Which of the following is a true statement about the quote? This is a quote from the Mayflower Compact and reflects the principle of self-government. This is a quote from the Magna Carta and reflects the principle of limited monarchy. This is a quote from Common Sense and explains why the American colonists should declare independence. This is a quote from the English Bill of Rights and describes the basic rights of all citizens. PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!! what signals the end of the cell cycle i. Solar cells are marketed (advertised) based upon their maximum open-circuit voltages and maximum short-circuit currents at Standard Test Conditions (STC). A. What is the definition of STC for a solar panel?B. From what you measured how would you "advertise" the capability of this solar cell? C. Why are your maximum measured values not necessarily representative of the how a solar cell is actually used? ii. If the same light source were moved farther away, how would this affect the current and voltage measured at the output of the solar panel? Explain why. ii. If the same light source is used, but the solar panel temperature is much hotter, how would this affect the current and voltage measured at the output of the solar panel? Explain why. iv. If you were given access to multiple solar panels of the same model, design a circuit to achieve: A. 3 times more current B. 3 times more voltage A function is defined by f(x) = x+2, 0. A region R is enclosed by y = f(x), the y-axis line y = 4.Find the exact volume generated when the region R is rotated through 27 radians about the y-axis. Hi 123-123+123+123=???? Which of the following expressions are equivalent to 10 12? Choose all answers that apply: . 2.5 - 6 B.2(5 - 6) C.None of the above Approximately how many Tejanos(Mexicans living in Texas) were livingthere around 1800?A. 3000B. 10,000C. 22,000 Required information Skip to question [The following information applies to the questions displayed below.] The December 31, 2021, adjusted trial balance for Fightin' Blue Hens Corporation is presented below. Accounts Debit Credit Cash $ 10,400 Accounts Receivable 134,000 Prepaid Rent 4,400 Supplies 22,000 Equipment 240,000 Accumulated Depreciation $ 119,000 Accounts Payable 10,400 Salaries Payable 9,400 Interest Payable 3,400 Notes Payable (due in two years) 24,000 Common Stock 140,000 Retained Earnings 44,000 Service Revenue 340,000 Salaries Expense 240,000 Rent Expense 12,000 Depreciation Expense 24,000 Interest Expense 3,400 Totals $ 690,200 $ 690,200 Required: 1. Prepare an income statement for the year ended December 31, 2021. ok so Im getting banned and these cant go to waist so have fun :D For the following nonlinear system, 73 2 = y + 3x2 + 3x 91(x, y) = 7 y2 + 2y X 2 92(x, y) = 2 y = use the initial approximation (po, qo) = (-0.3, -1.3), and compute the next three approximations to the fixed point using (a) Jacobi iteration (b) Seidel iteration. A corporation sold 18,500 shares of its $10 par value common stock at a cash price of $11 per share. The entry to record this transaction would include Multiple Choice O A debit to Cash for $185.000 A NO LINKS PLEASE!!!!What do you know about the Cold War? Who was involved? Why do you think it was called the cold war? What do you know about the 1950s? What was the culture like at that time?