what does a person have to do to be considered a member of society?

Answers

Answer 1

Explanation:

Used in the sense of an association, a society is a body of individuals outlined by the bounds of functional interdependence, possibly comprising characteristics such as national or cultural identity, social solidarity, language, or hierarchical structure.


Related Questions

According to a study reported in the text, one result of Rogerian psychotherapy may be that Group of answer choices people report feeling like they become closer to their ideal selves. people establish their own conditions of worth. clients report feeling more experiences of flow. clients meet their hierarchy of needs.

Answers

Answer:

people report feeling like they have become closer to their ideal self

Explanation:

Hello. Unfortunately you did not submit the study the question refers to. However, it is possible to consider that the answer presented above is the correct answer, because Rogerian psychotherapy is a type of therapy centered on the individual, with the objective of making the individual recognize and understand their ideal self, which can promote many improvements in the the individual's life. This type of therapy was developed by Carl Roger in 1940.

state any three moral significance of a christian​

Answers

Answer:

Though we commonly think of worship as being for God's benefit, humans are also uplifted through the action of corporate worship. In this article, written from a sociological position, the author explains that the regularity of worship serves to maintain the individual in a continual state of moral tension. In worship the filter through which one views the world is regularly challenged, amended, and revitalized.

Explanation:

1. In the Declaration of Independence, which of the following is a grievance presented to the King of England concerning the treatment of the American colonies?
a. The King had not offered citizens of the colonies the right to a lawyer
b. The King has refused to pass other Laws for the accommodation of large districts of people
c. The King had ignored all the elected officials of the colonies in area of human rights
d. The King was not obeying the Rights of Man and Citizen outlined in John Locke’s writings

Answers

Answer:

C is the correct answer

Explanation:

I learned about this last year and had the same question.

TIME REMAINING
01:06:52
Read the poem "Autumn" by Emily Dickinson.

The morns are meeker than they were,
The nuts are getting brown;
The berry's cheek is plumper,
The rose is out of town.

The maple wears a gayer scarf,
The field a scarlet gown.
Lest I should be old-fashioned,
I'll put a trinket on.

Which statement best explains the central idea of the first stanza?

Autumn is less enjoyable than summer.
Autumn is the time to harvest fruit.
Nature provides signs of autumn.
Nature is inactive in autumn.

Answers

Answer:

Nature provides signs of autumn.

Explanation:

Emily Dickinson's poem "Autumn" is a short poem of two stanzas where the poet talks of the season of autumn. The eight lines of the poem show or express the visible signs that suggest autumn is here.

The signs such as "nuts getting brown", plump berries, scarlet fields, etc. are all suggestive of the autumn season. And in painting the image of the mellowed scene of autumn, the speaker/poet expresses the central idea of nature providing signs of the autumn season.

Thus, the correct answer is the third option.

Museum Indians - Compare and contrast the personalities of the narrator and her mother. Cite text evidence in your response.

Answers

Answer:

Following are the solution to the given question.

Explanation:

The narrator and mother have different personalities in the "Indian Museums" of Susan Power that can impact their interpretations of life. Power's mother is an American native that had to abandon her tribe for employment and who suffered abuse by those of her community. It's why she has a triste attitude that her child cannot grasp since Power rises in a town and has the little touch with the people of her mother. Strength is less spiritual, due to severe contact with his mother.

The largest institution in the world devoted to drug abuse research is the: A. National Institute on Drug Abuse (NIDA). B. Office of National Drug Control Policy (ONDCP). C. Bureau of Alcohol, Tobacco, Firearms, and Explosives (ATF). D. Substance Abuse and Mental Health Services Administration (SAMHSA).

Answers

Answer:

A. National Institute on Drug Abuse (NIDA)

Explanation:

name and explain two laws that protect citizens against xenophobia​

Answers

Answer:In the U. S. there are no laws against xenophobia. ... In this case, equality under the law plays a key role in preserving these rights. The government and its citizens are obligated to honour and respect the Bill of Rights and the constitution for the country to run smoothly.May 19, 2021

hoped this helped you!! :) also if u need anything else lemme know :D

how did dance change Michael Jackson life ?​

Answers

Answer: it made him famous a long with his voice

Explanation:

¿Deberían los EE. UU. Enviar tropas para luchar en Corea?

Answers

Answer:

Translation: Should the US send troops to fight in Korea?

Explanation:

I'm not sure how to answer but hope that helps!

What is a society? Write any 5 features of a society ​

Answers

Answer:

A Society Is Basically members of a community or group That is  considered together.

Explanation:

Malik has been taking Haldol, a conventional antipsychotic drug, as a treatment for his paranoid schizophrenia. He began taking the drug last week and has begun shaking involuntarily, experiencing discomfort in his limbs, muscle rigidity, and displaying involuntary movements of his face. Malik has developed which side effect of the drug

Answers

Answer:

The answer is "Parkinsonian symptoms".

Explanation:

Parkinson's disease is a condition that produces a combination of motion abnormalities such as shaking, slow-movement, slurred vision, or joint pain, in particular as a result of loss of nerve cells containing serotonin (neurons).

The illness is characterized by a deficiency of neurons significant neurodegeneration inside the part of the brain. Nerve cells were crucial for creating a substance called dopamine in this part of the brain.

Frica is the birthplace of humankind justify the statement esay wording for grade 3 my sister plz help

Answers

Answer:

Africa is the birthplace of humankind

Explanation:

Places like South Africa and East Africa is considered to be the birthplace of humankind. The idea that human evolution in Africa was given by Charles Darwin. Africa is also known as the cradle of Humankind. Fossil of early humans has been found in this region in a vast region that indicates the early human evolution.

Olivia is taking advanced placement biology in high school because she loves science and is fascinated by biology. Jacob is taking advanced placement biology in high school because his guidance counselor told him he had to if he intended to apply to a pre-med program at a competitive university. Olivia's behavior reflects _____, while Jacob's reflects _____.

Answers

Answer: intrinsic motivation; extrinsic motivation

Explanation:

Intrinsic motivation is doing something without any obvious reward from anyone. It is doing something born out of passion, drive, interest and what makes you happy. There is no room for pleasing anyone while doing it.

Extrinsic motivation is the opposite, which considers doing something to please others or for a reward at the end of the day.

Olivia is taking the course out of the passion she derives from it, while Jacob is doing so out of he needs it to scale through for pre-med program.

Which defines Olivia as being intrinsic and Jacob being extrinsic

‘Regulated markets are useful for the farmers, still they sell their produce in the unregulated market.' Why?

Answers

Answer:

Farmers prefer to sell their farm produce in unregulated market because they are they are not bound by rules and regulations, they are free to set prices of their produces to any amount they want and are in full control of whatever they do in the market unlike the regulated market where everything is controlled by the the statutory market organization who are standing on behalf of the various  sections involved in markets

Explanation:

Market

This is simply regarded as a meeting place meant for buyers and sellers or products and services

Market economy

This is simply referred to as an economic system where demand, supply, and the price system guides people decision making.

On the Basis of Extent of Public Intervention,  markets  can be regarded as a. Regulated Markets:  This is a type of Markets where business transactions follows the rules  and regulations as set up by the market statutory organization representing various  sections of the markets. Here,  marketing costs  are  often standardized and  practices are strictly monitored.

b) Unregulated Markets: These are the markets where business is carried out without  any rules and regulations being laid down. Traders are solely in charge of the rules for the conduct of the business and  how the market is to be run.  Disadvantages includes standardized charges  for marketing functions, irregular prices determination.

How does that rebellion compare to the Nat Turner rebellion?

Answers

Answer:

Explanation:

Nat Turner destroyed the white Southern myth that slaves were actually happy with their lives or too docile to undertake a violent rebellion. His revolt hardened proslavery attitudes among Southern whites and led to new oppressive legislation prohibiting the education, movement, and assembly of slaves.

What sparked the revolt? in brown's raid

Answers

Answer:On the morning of October 19, the soldiers overran Brown and his followers. Ten of his men were killed, including two of his sons. ... Brown's raid helped make any further accommodation between North and South nearly impossible and thus became an important impetus of the Civil War.

Explanation: It was the first such national crisis to be publicized using the new electrical telegraph. Reporters were on the first train leaving for Harpers Ferry after news of the raid was received, at 4 p.m. on Monday October 17.

Please give me the answer and show me how you solved it

Answers

Answer:the answer is a and you multiply

Explanation:

list any four social Institutions and also mention what social behaviour an individual learns from such Institution. 5 marks​

Answers

Four social institutions are;
Family- this is where an individual is first accepted and nurtured emotionally, materially, psychologically. This institution marks the fundamental development of an individual.

Religion- this institution provides a space whereby the individual can address issues of faith, devotion and other phenomenal experiences they undergo that cannot be scientifically or physically explained and belief in a supreme being.

education- this institution teaches the individual the social behavior of learning and also teaching in some aspects. The individual learns to be a learner and philosopher by widening her or his mental or thinking horizon and is less susceptible to gullibility or ignorance.

Economy- the individual’s opportunities, security, and harmony rests in the success of this institution. It is where the individual learns to work as part of team towards an aim

Commercial fishing has long been one of the major industries of a coastal state. To protect the fishing industry and to promote the general welfare of the state's citizens, the legislature of the state enacted statutes requiring licenses for commercial fishing. An applicant for the license must pay a $300 fee and establish that he has been engaged in commercial fishing in the waters of the state for 10 years. A commercial fisherman residing in a neighboring state frequently takes his fishing boat up the coast. His favorite spot is approximately two miles off the coast of the legislating state.

If the commercial fisherman challenges the constitutionality of the legislating state's statutes, should the court find the statutes constitutional?
A. Yes, because Congress has not enacted legislation regarding the subject matter of the statutes.
B. Yes, because economic and social regulations are presumed valid.
C. No, because less restrictive means are available.
D. No, because Congress has exclusive power to regulate foreign commerce, which includes commercial ocean fishing.

Answers

Answer:

i think its D, sorry if im wrong tho

Explanation:

(っ◔◡◔)っ ♥ follow me ♥

˜”*°•.˜”*°• say thank you on profile •°*”˜.•°*”˜

░▒▓█ ℝαte █▓▒░

Write a well-written paragraph about whether or not you believe
that Andrew Jackson should remain on the twenty-dollar bill. HELP PLEASE

Answers

The correct answer to this open question is the following.

I believe that Andrew Jackson should be removed from the twenty-dollar bill.

The reason is simple. His behavior and decisions toward the Native American Indian tribes were not good. And recently, he has been criticized for that. Andrew Jackson supported slavery, and that is a negative spot in his legacy.

Andrew Jackson encouraged westward expansion and settlement by supporting the Indian Removal Act.

On May 28, 1830, United States President Andrew Jackson signed the Indian Removal Act that supported the westward expansion and invited many Americans to settle territories in the west. These were territories west of the Mississippi, and the President could grant lands in exchange for Native American Indian tribes' lands that already existed within the known US territory.

So this act gave powers to the US President to negotiate the removal of the Native Indians to other territories. The President wanted to support white settling to farm the lands and make them productive.

Based on the text what is the difference in time between practing for the Paralympic basketball team and for track and field

Answers

Incomplete question. The full question read;

9. Read these sentences from the text.

"Soon, though, Thompson knew she had to get a job. She knew that training for track and field took too much time to allow her to work. So she tried out for the U.S. Paralympic women's basketball  team instead, and she made it."

Based on the text, what is the difference in time between practicing for the Paralympic basketball team and training for track and field?

Explanation:

From the text, remember we are told Thompson intended to get a job, but "she knew...training for track and field" would take up more time that wouldn't allow her to hold a job.

So the difference in time between practicing for the Paralympic basketball team and for track and field was that practicing for the Paralympic basketball team consumes a lesser amount of time than training

for track and field.

Which statement is true about groups?

Answers

I am pretty sure the answer is B. The rest are opinions and usually opinions are never the answe :$
Maybe it could be B since it’s seems like a good option

what areas of life still need to improve for women? support answer with examples.

thanks in advance if someone answers!:)​

Answers

Answer:

Areas of life still need to improve for women are:-

More Rights for the LGBT Community.Equal Pay for Women. Less Discrimination In General. More Focus On Anti-Violence. More Awareness and Accessibility To Abortion.

Areas life still needs to improve for women are:

1. They usually don't get equal pay. They should get equal pay.

2. They are supposed to manage the household along with their job. Household responsibilities should be equally divided.

3. They are supposed to take care of children, like attending their parents' meeting and they are the one who take leave when the child is sick. Both parents should have equal responsibilities.

If the US placed a 25% tariff on all goods produced outside the US there would definitely
be an increase in jobs in the US?
O True
O False

Answers

The answer is True .......

The American Social Security System, established by the New Deal, differed from most European social welfare systems primarily because it a was opposed by large sectors of the public. b did not initially cover all categories of workers. c linked unemployment and disability insurance to old age pensions. d did not permit the Social Security number to be used for identification and security purposes. e did not address the issue of single mothers in the home with dependent children

Answers

Answer:

b. did not initially cover all categories of workers.

Explanation:

The American Social Security System was very different from what we know today, in its early years of establishment, during the New Deal. The main difference was that it did not cover all professional categories (which made it different from the European pension system). Professional categories were included in this system as the US economic condition strengthened through other New Deal reforms. This happened little by little, until it became what we know today.

Which of the following are characteristics of the Social Age? Multiple select question. Problems are addressed by groups. Communication between people is networked. Information is shared primarily through face-to-face communication. Teamwork is not limited by boundaries.

Answers

Answer:

✓Communication between people is networked.

✓Teamwork is not limited by boundaries.

✓Problems are addressed by groups.

Explanation:

Social Age can be regarded as which compose of societal as well as technological changes which succeed the Information Age.It can be regarded as a divergence of Information Age, this age provide prominence to social factors in the course of adopting as well as extending technology and information. Some of the following are characteristics of the Social Age include;✓Communication between people is networked.

✓Teamwork is not limited by boundaries.

✓Problems are addressed by groups.

how do you think worldview, culture, and beliefs are expressed in modern art (imagery, movies, books, songs, sculptures, etc.)? give examples to support ur answer.

i would really appreciate anyone's help asap, thanks in advance!​

Answers

Answer:

art is an expression using cultural symbols. Look at the art of the Northwest Coast culture area. Chances are you probably won't understand it, in the sense you can describe symbols an know their meaning within the culture these represent. Art is form of culture as poems are an express meaning using cultural symbols.

The Incan poeple made knives, chisels, and bells from_____________. A) gold B) silver C) bronze D) steel

Answers

Answer:

Option C: Bronze

Explanation:

Incan Empire  

This was known to be one of the largest empire ever seen in Americas. The capital of the Incan Empire was said to be Cuzco and  it was located in South Peru, South America.

Metalwork in Incan Empire

This was said to ranks below stonework, textiles and feather work. They uses Copper and bronze, for making basic farming tools and weapons e.g. club-heads, knives with curved blades, axes, chisels, needles, sharp sticks for digging etc. Metallurgists in Incan are solely responsible for making metal tools and weapons in all part of the empire.

what is the National Bank veto

Answers

National Bank veto is the second Bank in July 1832 by arguing that in the form presented to him it was incompatible with “justice,” “sound policy” and the Constitution.

Give me the brainliest.

During the presidency of John Adams, both France and Britain
A supported American Indians.
B impressed US sailors.
C demanded bribes to create peace.
D seized US ships.

Answers

Answer:

D.seized US ships..........

Other Questions
Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts Whoever answers these 2 right gets brainliest and 25 points! please help me :(Any Maths Moderator:( please help me; I am in great trouble I need help with another too! :( I will mark brainliest! You will get 30 piontsthe picture is right there too! The question is also in the picture too!I hope you could see it clrealy! Find the value of x. 0.45 written as a common fraction, in its simplest form, is Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer PLZ HELP ASAP!!!!!!!!!!!!!! A store has two different coupons that customers can use. One coupon gives the customer $15 off their purchase, and the other coupon gives the customer 30% off of their purchase. Suppose they let a customer use both coupons and choose which coupon gets applied first. For this context, ignore sales tax.Let f be the function that inputs a cost (in dollars) and outputs the cost after applying the "$15 off" coupon, and let g be the function that inputs a cost (in dollars) and outputs the cost after applying the "35% off" coupon. a. Suppose acustomerwants to purchase asi 40 item and apply the si 5 of coupon first, and then the 35% or coupon How much will the item cost after applying the coupons?b. Suppose a customer wants to purchase a S 140 item and apply the SI 5 off coupon first, and then the 35% or coupon Ure ction notation to represent how much the item will cost (dollars) after applying the coupons. c. Suppose a customer wants to purchase a $140 item and apply the 35% om coupon first and then the sis of coupon How much will the item cost after applying the coupons?d. Suppose a customer wants to purchase a S 140 item and apply the "35% or coupon first and then the "S 15 off coupon. Usefu ction notation to represent how much the item will cost (dollars) after applying the coupons. Population, 1860-1920Year Percent Rural Percent Urban186080.219.8187074.325.7188071.828.2189064.935.1190060.439.6191054.445.6192048.851.2Which of the following statements is TRUE about the information displayed in thetable above?Between 1860 and 1880, rural population increased.Between 1860 and 1920, people began moving to cities.Between 1910 and 1920, rural and urban populations were even.D Between 1860 and 1920, urban and rural populations remained stable.