What is depicted as the yellow arrows in the following image? (Using a scientific vocabulary word we learned in class and provide its definition) Which makes a bigger current- faster moving electrons or slower moving electrons?

What Is Depicted As The Yellow Arrows In The Following Image? (Using A Scientific Vocabulary Word We

Answers

Answer 1

Answer:

Electric Current

Explanation:

The yellow arrows in the following image depict electric current. Electric current is defined as the continuous flow of electrons in an electric circuit.  Electrons present in the conducting material which move from one to another atom randomly from the negative terminal through the connecting wires and back to the positive terminal.

Faster moving electrons make a bigger current because faster moving electrons collide more with each other that generates more heat which results into a higher current.

Hence, The yellow arrows in the following image depict electric current and Faster moving electrons make a bigger current.

Answer 2

The yellow arrow in the diagram shows the flow of electrons.

Current is defined as the flow of electrons in a circuit. The yellow arrows represents the direction of the flow of electrons in the circuit. The battery provides the potential difference that drives the flow of electrons through the wire.

Since current has to do with the movement of electrons in a circuit, the faster the movement of the electrons, the bigger the current.

Learn more: https://brainly.com/question/8646601


Related Questions

Are the atoms really "sharing" electrons

Answers

No they are donating them

A sound wave moves from a solid material into a liquid. What would happen to the frequency of the sound?

Answers

The frequency of the sound waves travel faster and more effectively in liquids than in air and travel even more effectively in solids.

How many moles are in 2.43 x 1024 particles of Carbon Monoxide (CO)?

a.0.25 moles
b.4.04 moles
c.1.46 moles
d.2.53 moles

Answers

b.

(2.43*10^24)*1/(6.022*10^23)

how to find the electron in an atom/element

Answers

Answer:

to find the number of electrons an element has locate it on the periodic table of elements find the atomic number and note the number of protons because they are naturally electrically neutral

Answer:

M-A=N

Explanation:

M-A=N

Here is an example.

The equation above means that the atomic number (A) subtracted from the average atomic mass (M) equals the combined amount of neutrons and protons. Since we know that 35 17Cl is Chlorine (this is because Chlorine (Cl) is the 17th number on the periodic table and has the average atomic mass of 35), we can insert our data into the equation and end up with the following:

35-17=18.

From here, we can tell that we have a mix of neutrons and protons, with the total being 18. Since the atomic number is 17, we can reasonably assume that there are 17 protons and 1 neutron.

But we still need to find the number of electrons. Fortunately, the number of electrons is always equivilant to the number of protons and the atomic mass, so we know that the number of electrons is 17.

So, we have;

17 Protons

1 Neutron

17 Electrons

the force that holds paticles together in the atomic nuecleaus?

Answers

Explanation:

i believe you meant particles*

Someone please help will mark as brainliest

Answers

Answer:

a1

The main difference between SPECT and PET scans is the type of radiotracers used. While SPECT scans measure gamma rays, the decay of the radiotracers used with PET scans produce small particles called positrons. A positron is a particle with roughly the same mass as an electron but oppositely charged.

Explanation:

a2

While imaging tests such as X-rays can show what the structures inside your body look like, a SPECT scan produces images that show how your organs work. For instance, a SPECT scan can show how blood flows to your heart or what areas of your brain are more active or less active.

a3

PET and SPECT have been extensively evaluated as diagnostic procedures for dementia. Substantial progress has been made in developing radioligands that bind to amyloid deposits in the brain, which should provide new opportunities for early diagnosis and treatment monitoring in Alzheimer's disease

a4

What are the disadvantages of spect as compared to pet?

However, SPECT has issues, including long scan times and low-resolution images prone to artifacts and attenuation. Some artifacts can easily be misidentified as perfusion defects. SPECT also does not provide a quantifiable estimate of the blood flow, whereas PET does, experts say.

What happens when a virus becomes latent?

Answers

Answer:

the full viral genome is retained in the host cell, but its expression is dramatically restricted, such that few viral antigens and no viral particles are produced.

Explanation:

Not much viral particles are made

How to we measure energy?

Answers

Answer:

The official measurement unit for energy is the Joule (J). Among the most common units measuring energy mention should be made of the kilowatt/hour (kWh), used especially for electric energy (in fact it is used to calculate electricity bills).

With joules hope I helped

Help me please:(:(:( with my bellwork
for brainiest

Answers

Answer:

Elements are made of only one kind of atom

Compounds are made of 2 or more elements chemically bonded together

Explanation:

Its right there????

Someone please help will mark as brainliest

Answers

1. solute is the substance that is being dissolve,while solvent is dissolving medium

2.saturated is solution that contain maximum amount of solut that capable of being dissolve and supersaturated is solution that contain less amount or medium of solut that capable being dissolve : example vinger

3. is a number placed in front of a chemical symbol or formula. It shows how many atoms or molecules of the substance are involved in the reaction. For example, two molecules of hydrogen would be written as 2 H2, and two molecules of water would be written 2 H2O . yes it's can be change only in caseWhen you balance an equation you can only change the coefficients

a flask of 0.30 L was weighted after it had been evacuated.It was then filled with a gas of unknown molecular mass at 760 mm of Hg and temperature of 300 K. The increase in mass of flask was found to be 0.997 g. Determine the molecular mass​

Answers

The molecular mass​ : 81.72 g/mol

Further explanation

In general, the gas equation can be written  

[tex]\large {\boxed {\bold {PV = nRT}}}[/tex]

where  

P = pressure, atm , N/m²

V = volume, liter  

n = number of moles  

R = gas constant = 0.082 l.atm / mol K (P= atm, v= liter),or 8,314 J/mol K (P=Pa or N/m2, v= m³)

T = temperature, Kelvin  

P = 760 mmHg=1 atm

T = 300 K

V = 0.3 L

Number of moles :

[tex]\tt n=\dfrac{PV}{RT}\\\\n=\dfrac{1\times 0.3}{0.082\times 300}\\\\n=0.0122[/tex]

The molecular mass (MW) :

[tex]\tt MW=\dfrac{mass}{n}\\\\MW=\dfrac{0.997~g}{0.0122}\\\\MW=81.72~g/mol[/tex]

explain how to separate sugar from supersaturated sugar solution
guys pls help

Answers

A “supersaturated” solution contains more dissolved material. supersaturated solutions lies in the temperature of the water. more sugar will dissolve in hot water than in cold. Meaning that by separating the 2, only the supersaturated sugar would dissolve leaving the regular sugar untouched.

Which will diffuse the most? The particles with the
A. Least potential energy.
B. Most potential energy.
C. Least kinetic energy.
D. Most kinetic energy.

Answers

Answer:

B. Most potential energy

Explanation:

brainest plz

How can magnetic force be exerted on objects?

1)Over a distance and anytime an object is in a magnet's field of influence.

2)Only through objects.

3)Only by touching an object.

Answers

I think the answer is : 1

How much oxygen (O) is in 5.41 × 106 atoms of oxygen

Answers

Answer:

They show you  how to do it sweetie

Explanation:

123456789 Common math

Aqueous solutions of sodium carbonate and magnesium chlorate are mixed

Answers

Explanation:

You're mixing magnesium nitrate, Mg(NO3)2 , and sodium carbonate, Na2CO3 , two soluble ionic compounds that dissociate completely in aqueous solution to form cations and anions.

Question:
In a laboratory demonstration, a balloon filled with methane and oxygen was exposed to a
flame. The result was a brief, large flame. The students were asked to formulate an equation for
the reaction. One answer is below.
CH, + 0 = CO,
This equation is incorrect.
A. Explain how and why it is incorrect
B. What would the correct equation be, and how do you know that?

Answers

Answer:

The laboratory demonstration consists of the following;

The compounds present in the combustion reaction = Methane, CH₄ and Oxygen, O₂

The chemical equation for the combustion reaction is given as follows;

CH₄ + 2O₂ → CO₂ + 2H₂O

Therefore;

A. The equation given as CH₄ + O → CO₂ is not correct because;

1) Oxygen gas exist as diatomic molecules, O₂, and given that the experiment involves the mixture of gases, the oxygen gas present which can exist as a separate compound, should be represented as O₂

2) The number of oxygen molecules in the reaction is two rather than one

3) The product also includes two molecules of water (vapor) H₂O

B. The correct equation for the reaction should be given as follows;

CH₄ + 2O₂ → CO₂ + 2H₂O

B i) The constituents of the equation is obtained by the knowledge of the fact that the combustion reaction of an organic substance such as methane in the presence of oxygen yields, carbon dioxide and water (vapor)

The equation showing the relative amounts the reacting compounds is by balancing the basic equation of the combustion of methane in the presence of oxygen

Explanation:

what is an extensive prperty of matter

Answers

Answer:

Volume

Mass

Size

Weight

Length

Explanation:

Extensive properties do depend on the amount of matter that is present. An extensive property is considered additive for subsystems. Examples of extensive properties include:

Volume

Mass

Size

Weight

Length

Ethanol (C2H5OH) melts at –114 °C and boils at 78 °C. The enthalpy of fusion of ethanol is 5.02 kJ/mol, and its enthalpy of vaporization is 38.56 kJ/mol. The specific heats of solid and liquid ethanol are 0.97 J/g-K and 2.3 J/g-K, respectively. The average specific heat of gaseous ethanol is about 1.80 J/g-K. a. How much heat is required to convert 35.0 g of ethanol at 27 °C to the vapor phase at 120 °C? b. How much heat is required to convert the same amount of ethanol at –120 °C to the vapor phase at 120 °C?

Answers

Answer:

First question

       [tex]Q = 36826 \ J[/tex]

Second  question  

       [tex]Q = 52299.7 \ J[/tex]

Explanation:

From the question we are told that

     The melting point of Ethanol is  [tex]T_m = -114 ^oC[/tex]

      The boiling point of Ethanol is  [tex]T_b = 78^ oC[/tex]

       The enthalpy of fusion of Ethanol is [tex]F = 5.02 \ kJ / mol = 5.02 *10^{3}\ kJ / mol[/tex]

        The enthalpy of vaporization  of Ethanol is [tex]L = 38.56 \ kJ / mol = 38.56 *10^{3} \ J / mol[/tex]

         The specific heat of solid Ethanol is  [tex]c_e = 0.97 \ J/ g \cdot K[/tex]

          The specific heat of liquid  Ethanol is [tex]c_l = 2.3 \ J / g \cdot K[/tex]

           The mass of the Ethanol given is  [tex]m = 35.0 \ g[/tex]

Considering the first question

           The initial  temperature is [tex]T_i = 27^oC[/tex]

             The final  temperature is  [tex]T_f = 120^oC[/tex]

Generally the heat required too raise the Ethanol to its boiling point is mathematically represented as

       [tex]Q_1 = m * c_l * (T_b - T_i)[/tex]

=>      [tex]Q_1 = 35.0 * 2.3 * ( 78 - 27)[/tex]

=>      [tex]Q_1 =4106 \ J[/tex]

Genially the number of moles of Ethanol given is mathematically represented as

         [tex]n = \frac{m}{Z}[/tex]

Here Z  is the molar mass of Ethanol  with value  [tex]Z = 46 g/mol[/tex]

So

         [tex]n = \frac{35}{46 }[/tex]

=>      [tex]n = 0.7609 \ mol[/tex]

Generally the heat of vaporization of the Ethanol is mathematically represented as

         [tex]Q_2 = n * L[/tex]

=>        [tex]Q_2 =0.7809 * 38.56 * 10^{3}[/tex]

=>        [tex]Q_2 =29339 \ J[/tex]

Generally the heat required too raise the Ethanol from  its boiling point to  [tex]T_f[/tex]  is  mathematically represented as

       [tex]Q_3 = m * c_l * (T_f - T_b)[/tex]

=>     [tex]Q_3 = 35 * 2.3 * (120 - 78 )[/tex]

=>     [tex]Q_3 = 3381 \ J[/tex]

Generally the total heat required is  

     [tex]Q = Q_1 + Q_2 + Q_3[/tex]

=>   [tex]Q = 4106 + 29339 + 3381[/tex]

=>   [tex]Q = 36826 \ J[/tex]

Considering the second question

           The initial  temperature is [tex]T_i = -120^oC[/tex]

             The final  temperature is  [tex]T_f = 120^oC[/tex]

Generally the heat required too raise the Ethanol to its melting  point is mathematically represented as

       [tex]Q_1 = m * c_e * (T_m - T_i)[/tex]

=>      [tex]Q_1 = 35.0 * 0.97 * ( -114 - (- 120) )[/tex]

=>      [tex]Q_1 = 203.7 \ J[/tex]

Generally the heat of fusion  of the Ethanol is mathematically represented as

                 [tex]Q_2 = n * F[/tex]

=>        [tex]Q_2 =0.7809 * 5.02 *10^{3}[/tex]

=>        [tex]Q_2 =3920 \ J[/tex]

Generally the heat required too raise the Ethanol to its boiling point is mathematically represented as

       [tex]Q_3 = m * c_l * (T_b - T_m)[/tex]

=>      [tex]Q_3 = 35.0 * 2.3 * ( 78 - (- 114) )[/tex]

=>      [tex]Q_3 =15456 \ J[/tex]

Generally the heat of vaporization of the Ethanol is mathematically represented as

         [tex]Q_4 = n * L[/tex]

=>        [tex]Q_4 =0.7809 * 38.56 * 10^{3}[/tex]

=>        [tex]Q_4 =29339 \ J[/tex]

Generally the heat required too raise the Ethanol from  its boiling point to  [tex]T_f[/tex]  is  mathematically represented as

       [tex]Q_5 = m * c_l * (T_f - T_b)[/tex]

=>     [tex]Q_5 = 35 * 2.3 * (120 - 78 )[/tex]

=>     [tex]Q_5 = 3381 \ J[/tex]

Generally the total heat required is  

     [tex]Q = Q_1 + Q_2 + Q_3+Q_4 + Q_5[/tex]

=>   [tex]Q = 203.7 + 3920 + 15456 +29339+3381[/tex]

=>   [tex]Q = 52299.7 \ J[/tex]

Explain why the electron configuration of 2-3-1 represents an atom in an excited state?

Answers

Answer:

See explanation

Explanation:

If we look at the electron configuration closely, we will discover that the element must have had a ground state electron configuration of 2,4.

This is because, the innermost shell usually holds two electrons while the outer shells hold eight electrons each. The four electrons must be accommodated in the second shell in the ground state configuration of the compound.

However, when the atom is excited, one electron from this shell may move to the third shell to give the excited state configuration 2-3-1 as shown in the question.

You have discovered an element that is a poor conductor of electricity, has a low melting point, and is a gas at room temperature. How would you classify this element?


A.metal

B.metalloid

C.actinoid

D.nonmetal

Answers

AHHH ITS B SORRY I ACTUALLY KNOE THIS

what are the three types of nuclear decay or reactions?

Answers

Answer:

alpha decay, beta decay, gamma decay

What is a mixture of sugar and water?

a solution

molecule

a compound

a precipitate

Answers

Explanation:

I think its a solution just me tell me in comments if right

Answer:

A solution

Explanation:

Sugar is soluble in water and would dissolve into the water to form a solution.

If you have 2.0 moles of sodium chloride (NaCl), what is its mass in grams?

Answers

Answer:

117g

Explanation:

Given parameters:

Number of moles = 2moles

Unknown:

Mass of NaCl  = ?

Solution:

To solve the problem, we need to use the expression below;

    Mass of NaCl  = number of moles x molar mass

Molar mass of NaCl  = 23 + 35.5  = 58.5g/mol

 

So;

Insert the parameters and solve;

     Mass of NaCl  = 2 x 58.5  = 117g

Which of the following is an intensive property?

Mass
Magnetism
Shape
Volume

Answers

Answer:

I believe its A. Mass

Explanation:

An intensive property is a property of matter that depends only on the type of matter in a sample and not on the amount. For example, the electrical conductivity of a pure substance is a property that depends only on the type of substance. Silver, gold, and copper are excellent conductors of electricity, while glass and plastic are poor conductors.. Other intensive properties include color, temperature, density, and solubility.

Answer:

B. Magnetism

Explanation:

Hope this helps! :))
Sorry for late answer

How many grams are in 7.5 moles of C6H12?



Group of answer choices

0.09g

630g

11.2

84g

Answers

Answer:

630gC₆H₁₂

Explanation:

How many grams are in 7.5 moles of C₆H₁₂?

C₆:12.011×6=72.066

H₁₂:1.008×12=12.096

72.066+12.096=84.162

84.162g/mol C₆H₁₂

7.5 molC₆H₁₂ ×84.162g/molC₆H₁₂= 631.215gC₆H₁₂

help with this question

Answers

Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

The chemical equation describing the burning of hydrogen gas is: 2H2 + O2 ---> 2H2O.
Why is this both a synthesis and a combustion reaction?

Answers

Answer:

"A combustion reaction is a reaction in which a substance reacts with oxygen gas, releasing energy in the form of light and heat. Combustion reactions must involve O2 as one reactant. The combustion of hydrogen gas produces water vapor." and "A synthesis reaction occurs when two or more reactants combine to form a single product. ... In a double replacement reaction, two compounds exchange elements. A combustion reaction occurs when a substance reacts quickly with oxygen. Combustion is commonly called burning"

Explanation:

I tried

5. Which of the following elements will have a charge of 4+ or 4- as an ion?

Answers

Answer:

The answer would either be Carbon or Silicon.

Explanation:

Can farmers simply plant more acres of crops to feed a growing population?

Answers

Answer:

I believe they can if it's a small town/village

Explanation:

Other Questions
Explain How To Find The Volume Of Any Rectangler PrismBtw 20 points DRAW A PEDIGREERead the following information and ON NOTEBOOK PAPER, construct a pedigree using the symbols we went over Tuesday: Scott is married to Christa. They have 3 children, Blake (a son), Peyton (a daughter), and Ashton (a daughter). Blake is married to Allie and they have 2 children, Henry (a son) and Harper (a daughter). When you have completed your pedigree drawing, take a picture and attach it to this assignment and submit. How does the authors use of characterization develop the passage?A. It highlights the internal conflict that Peter faces throughout the narrative.OB.It highlights Peter's individuality, which distinguishes him from normal social expectationsC. It highlights the emotional connection that Peter shares with the narrator.D. It highlights Peter's background, which plays an important role for developing the mood.ResetNext pls pls pls pls pls pls help!!!!!!!!!!!Read the passage below.You will respond by writing an informational response paragraph.You will find specific writing directions below the passage.GOLD IN THE SKYBy Alan E. NourseChapter 1. Trouble Times TwoThe sun was glowing dull red as it slipped down behind the curving horizon of Mars, but Gregory Hunter was not able to see it.There was no viewscreen in the ship's cabin; it was too tiny for that. Greg twisted around in the cockpit that had been built just big enough to hold him, and shifted his long legs against the brace-webbing, trying to get them comfortable.He knew he was afraid ... but nobody else knew that, not even the captain waiting at the control board on the satellite, and in spite of the fear Greg Hunter would not have traded places at this moment with anyone else in the universe.He had worked too hard and waited too long for this moment.He heard the count-down monitor clicking in his ears, and his hands clenched into fists. How far from Mars would he be 10 minutes from now? He didn't know. Farther than any man had ever traveled before in the space of 10 minutes, he knew, and faster. How far and how fast would depend on him alone."All set, Greg?" It was the captain's voice in the earphones."All set, Captain.""You understand the program?"Greg nodded. "24 hours out, 24 hours back, 90 degrees to the ecliptic1, and all the acceleration2 I can stand both ways."Greg grinned to himself. He thought of the months of conditioning he had gone through to prepare for this run ... the hours in the centrifuge to build up his tolerance to acceleration, the careful diet, the rigorous hours of physical conditioning. It was only one experiment, one tiny step in the work that could someday give men the stars, but to Gregory Hunter at this moment it was everything."Good luck, then." The captain cut off, and the blastoff buzzer sounded.He was off. His heart hammered in his throat, and his eyes ached fiercely, but he paid no attention. His finger crept to the air-speed indicator, then to the cut-off switch. When the pressure became too great, when he began to black out, he would press it.But not yet. It was speed they wanted; they had to know how much acceleration a man could take for how long and still survive, and now it was up to him to show them.Fleetingly, he thought of Tom ... poor old stick-in-the-mud Tom, working away in his grubby little Mars-bound laboratory, watching bacteria grow. Tom could never have qualified for a job like this. Tom couldn't even go into free-fall for 10 minutes without getting sick all over the place. Greg felt a surge of pity for his brother, and then a twinge of malicious anticipation. Wait until Tom heard the reports on this run! It was all right to spend your time poking around with bottles and test tubes if you couldn't do anything else, but it took something special to pilot an XP ship for Project Star-Jump. And after this run was over, even Tom would have to admit it....There was a lurch, and quite suddenly the enormous pressure was gone.Something was wrong. He hadn't pushed the cut-off button, yet the ship's engines were suddenly silent. He jabbed at the power switch. Nothing happened. Then the side-jets sputted, and he was slammed sideways into the cot.He snapped on the radio speaker. "Control ... can you hear me? Something's gone wrong out here...."1The great circle that is the apparent path of the Sun.2The process of moving faster or happening more quickly.------------------------Now that you have read the passage, you will write an informational paragraph to answer the following question:How does this story create a feeling of tension or conflict?Read the directions carefully so you know what to include in your essay.Begin your paragraph by rephrasing the question into a topic sentence. Be sure to include the title and the author.Include 3 or more specific examples, details, or quotes from the passage to support your answers to the prompt.End with a conclusion sentence to wrap up your ideas.Proofread your work before submitting. 4(5 w) = 2(2w 3) Select two linear pairs. luisas restaurant bill comes to 75,50 and she leaves 15% tip what is luisas total restaurant bill why does nurse ratched want to be in control ?Cukoos Nest In addition to the American and French Revolutions, the Enlightenment inspired which revolution?A- Haitian Revolution B- Caribbean Revolution C- Seven Years WarD- Dominican Revolution $40 game; 30% off; 5% tax Christians believe that Jesus is the son of God, both fully God and fully man Identify the radius of the circle.Help ASAP pls!!!*its hw*! is -3/7 a rational or irrational number? I need help again I am Sorry what does ca. mean in history? The surface area of a cone is determined by the equation Identify the vertex of y = 2x2 4x 2 The ratio of blue chairs to red chairs in Ms. Vickers' class is 2 to 5. Which of the following cannot represent the total number of chairs in Ms. Vickers' class? A 14 C 28 B 20 D 35 In carbon dioxide (CO2), there are two oxygen atoms for each carbon atom. Each oxygen atom forms a double bond with carbon, so the molecule is formed by two double bonds.Two double bonds means that the total number of electrons being shared in the molecule istwo.four.six.eight. Which statement best describes Germany's overall military strategy at the beginning of World War 1?