Which of the following is the origin for the triceps brachii?
A. The tuberosity below the glenoid cavity of the scapula.
B. The lateral surface of the humerus.
C. The medial surface of the humerus.
D. All of the above

Answers

Answer 1

Answer:

B

Explanation:


Related Questions

Tanya enjoys being on the soccer team but she finds the fast food dinners her family eats are not providing the energy she needs both of her parents work long hours and pick up fast food meals on the way home as a quick way to feed the family

describe how tanya can help her parents and improve her energy level

Answers

Answer: She could try not to overwork herself, exercise, and eat foods like bananas, brown rice, sweet potato, eggs, apples, and drinking water. (That's what I do for energy)

Explanation:

write a reflection on parenting if good ill give u brain and a rate.

Answers

i’m answering so the other person can get brainly!! i’m not doing it for points. good parenting is always listening to you’re child and go with what they want. let them be free, let them do what they want. that’s just my opinion i hate when my parents are always on my back telling me what to do

Which of the following is an example of a STD?
A.
Arthritis
B.
Cancer
C.
Chlamydia
D.
Diabetes

Answers

Answer:

c

c

Explanation:

chlamydia not d Bec it's not

Answer:

Chlamydia

Explanation:

hope it helps

Which of the following should be a result of using practice management software?

Answers

Answer: saves time

Explanation:

Someone please help me

Answers

Answer:

C.) Botulism

Explanation:

PLEASE HELP!! WILL MARK BRAINLIEST!!~~~~
At the beginning of one week, a total of 12 people in a town had influenza. Two people were cured by the end of the week. Then, during the following week, three new people contracted the disease. Which statement is best supported by this information?
The incidence of the flu decreased by the end of the second week.
The incidence of the flu increased by the end of the second week.
The prevalence of the flu increased by the end of the second week.
The prevalence of the flu decreased by the end of the second week.

Answers

Answer:

The incidence of the flu decreased by the end of the second week.

Explanation:

At the beginning of the first week, there were 12 people who contracted influenza and decreased to 3 by the second week.

6th grade teacher pre ED i mark as brainliest​

Answers

Answer : its D snakakkqskjwkqql

It is best to eat within an hour of exercising.
Please select the best answer from the choices provided.
Т
F

Answers

Your answer is true .

Mira is a college senior and wants to enter the healthcare field. She attended a HOSA meeting during which a surgeon hosted a question and answer session for future healthcare workers. How did Mira benefit from attending the HOSA meeting?

Answers

Answer: Please see explanation column for answers

Explanation:

HOSA is Future Health Professionals  body  that guides  students  in the pursuit of their career development in the  healthcare fields  by providing effective instructional strategy and skills  to  achieve the goals of the Health Occupations Programmes while improving  the delivery of quality health care to everyone.

By attending the HOSA meeting, Mira was able

1.To Set realistic career  goals

2.Learn effective qualities and skills from professionals.

3. Gain Like  friends and improve her social network.

4. Get first hand answers on questions about the particular healthcare field she wants to enter.

5. Get motivated in the healthcare field and build self confidence.

Answer:

Answer is D She was able to make friends, improve her skills, and network.

Explanation:

Edge 2021

Which of these things could lead to type 2 diabetes? HHEELPP

Sexual activity
Smoking
Obesity
Taking drugs

Answers

Answer:

Obesity

Explanation:

yah no to a,b,and d so its c "obesity"

Pls Help!
Imagine you are the owner of a holiday camp with seven cabins. A group of five high school students will be staying with you for three days, starting next week. You need a list of meals {breakfast, lunch, and supper} to provide for the time you are camping. What would be a good meal plan for the duration of three days?
*If possible describe how it the cooked or prepared and list the needed ingredients to make the meals for breakfast, lunch, and supper.*

Answers

Answer:

Day 1:

Breakfast- Biscuits and Gravy served with eggs and toast

Lunch- the choice of soup or salad

Dinner- Chicken alfredo served with bread

Day 2:

Breakfast-Pancakes or Waffles with oatmeal

Lunch-Turkey Subs or Chicken salad served with mac& cheese

Dinner- spaghetti and Meatballs with mashed potatoes

Day 3:

Breakfast- an Omelete with bacon and toast

Lunch- Chicken and rice served with a salad

Dinner- Tacos or Burritos with a side salad

Improving the way you communicate to others by your actions, is to improve which area of effective communication?

A.Your speaking skills

B.
Your listening skills

C. Your body language

D. None of the above, your actions do not matter when communicating

Answers

Explanation:

C I think body language is the most important one

I believe it is
C. Your body language

Describe four skills that can distribute to effective communication.

Answers

Answer:

I think it's...

-Reading

-Listening

-Writing

-Speaking

(I'm so sorry if it's wrong)

Hope this Helps!

Why do you think the quality of life does not have any absolute measurement yard stick? Explain with examples​

Answers

Answer: You cannot measure what one person experiences and then use the measurements to measure another person who has never had those experiences, learned in different ways, and run their lives and learned their lessons in harder or easier ways. For instance:

Bobby has lived his life as the owner of a body shop(if you don't know, this is a place where people work on cars) Bobby dropped out of school at 15 to help his dad with said shop, and has been living a happy life, now 56 with two kids in high school and a lovely wife.

Now you have Craig, who from kindergarden up was a straight A student and now holds a gavel as one of the best judges in the United States. He went to Harvard, where he met his first girlfriend who dumped him two minutes before he walked on stage to graduate from Harvard. Craig now also 56 lives a happy life with no kids and a new girlfriend who he sees every Saturday.

Both men are successful and happy, but they got to where they are in very different ways. No you cannot measure that.

We cannot quantify just what individual views and then apply the measures to some other individual who has not had similar situations, learnt in other methods, and lived their entire lives and learned from their mistakes in different ways.

Examples;

Sam has spent his whole life as the proprietor of a small business. Sam dropped out of school when he was 18 to assist his father with the store, and he has been enjoying a happy life ever since. Sam has three children.Billy, who had been a sound student from elementary to high school and now sits behind the bench as one of the greatest judges in the country. Billy has a good life and does not have any children.Both men are prosperous and content, but they get there in quite different ways. No, we cannot quantify their happiness.

Learn more:

https://brainly.com/question/11622879?referrer=searchResults

describe the following; fats, proteins, carbs, sugars, and sodium

Answers

Answer:

(fats)In nutrition, biology, and chemistry, fat usually means any ester of fatty acids, or a mixture of such compounds; most commonly those that occur in living beings or in food.

(, proteins,) Proteins are large biomolecules, or macromolecules, consisting of one or more long chains of amino acid residues.

(carbs,) carbohydrate is a biomolecule consisting of carbon, hydrogen and oxygen atoms, usually with a hydrogen–oxygen atom ratio of 2:1 and thus with the empirical formula Cₘ(H₂O)ₙ.

(sugars) Sugar is the generic name for sweet-tasting, soluble carbohydrates, many of which are used in food. Table sugar, granulated sugar, or regular sugar, refers to sucrose, a disaccharide composed of glucose and fructose.

(sodium)Sodium is a chemical element with the symbol Na and atomic number 11. It is a soft, silvery-white, highly reactive metal.

i hope it help just copy and paste on a doc

Explanation:

My parents dont get that I am emo. I tried to explain to them that its no a phase because I have been emo since I was like 8. I was listening to MCR at 7. I am 15 now and they wont allow me to be emo. How do I convince them to allow the to let me be my own dark self? How do I get them to stop hating me without changing?

Answers

Answer:

Just be you and try not to care about what other people say about you and just try and explain to them at least that being emo is what makes you ,you BE YOURSELF dont care what they gotta say about you its your life if they dont like it then they gootta deal with it

Explanation:

Answer:

well they are going to have to learn to accept you i accept anyone as long as there nice so if they don't accept you they soon will if you prove them wrong by showing them that your amazing and can do anything!1 (: (;

Explanation:

What is the human reproductive system?

Question options:

a)

physical changes during adolescence


b)

When cells divide


c)

Human body systems and structures that make it possible to have children


d)

the process by which organisms produce others of their own kind

Answers

The answer is c haha

Enjoy these points! Make sure to love yourself and stay positive when things are rough.
Don't give up like me! It's not worth it. But it's too late for me.

Answers

Answer:

Thank you for the message hope you do well in your life :)

Explanation:

Explain why it's important to create a consistent schedule for your personal training plan.

Answers

Answer: Consistency is key to achieving goals.

Explanation: When there is an established schedule, the person has greater ease in following it and complying with it since when seeing it embodied, he knows that he has a responsibility. When there is a schedule for training, the person knows when to execute it and how there is a control and that leads to its realization more easily.

Those people who train and take it seriously have a set schedule. Schedules allow for order and when things are ordered people have a tendency to execute it.

Answer:

A consistent schedule provides adequate rest and recovery between exercise cycles of major muscle groups. For example, you should work out your upper body muscles every other day.

Explanation:

did on edg

What can make it more difficult for a person to remain drug-free?
A: peer pressure
B: planning ahead
C: being a role model
D: parental involvement

The correct answer will be: A - peer pressure ​

Answers

Answer:

A?

Explanation:

I’m confused because you seem to have the answer already

Answer:

A

Explanation:

Peer pressure makes more difficult for a person to remain drug free

Your date's parents are away for the weekend. He/she invites you over to watch movies on Saturday night. When you arrive, you discover that his/her older sister has brought some beer to liven up the evening. After your first beer, you start to have second thoughts, but you don't want your date to be mad at you. What should you do?

Answers

Answer:

Make up an excuse or text your parent to call you and make it seem like they really want you home and then have them come pick you up. Your parents shouldn't be mad when you tell them the truth and that you felt unsafe. But don't risk yourself for what some "friend" thinks, if they are truly your friend they will care about you and wouldn't put you in a situation like that.

Explanation:

Hope this helps!

Imagine that you are an independent essential oils sales representative and you wholeheartedly believe in the value of using oils for different reasons. Your sister is considering using oils for a few health issues like dry skin and asthma complications, as well as for air purification and cleaning. However, she isn't totally sold on their effectiveness. What would you say to her? How would you convince her of the usefulness of oils? Use specific examples/information from your research and the article.

Answers

Essential oils are a commonly used item. They often help with many things. Like for example the peppermint oil can help you breath better, lavenders are known to calm you, and other ideas. (You might wanna re-word this because this probably doesn’t even make sense but)

One item that is frequently used is essential oils. They frequently assist with numerous tasks. For instance, lavender flowers are known to soothe you, and there are more alternatives. Peppermint oil can also help you breathe more easily.

What are essential oil?

Essential oil are defined as a concentrated hydrophobic liquid made of plant chemicals that are volatile (quickly evaporate at room temperature). Essential oils have a pleasant scent, lower stress levels, treat fungus infections, and promote sleep. They are concentrated plant extractions.

The most crucial aspect of essential oil safety is dose. In animal and laboratory research, it has been discovered that some essential oils taken in the improper amounts or at too high a concentration might cause tumor development and other negative effects in the body.

Thus one item that is frequently used is essential oils. They frequently assist with numerous tasks. For instance, lavender flowers are known to soothe you, and there are more alternatives. Peppermint oil can also help you breathe more easily.

To learn more about essential oil, refer to the link below:

https://brainly.com/question/28772231

#SPJ5

Why does having low levels of glucose or oxygen in his cells make it difficult

Answers

The blood is the best to get tested as it is the only means glucose and other relevant materials reaches their destination .

What is the function of the Biceps?
A.flex the abs
B:extend the quads
C.flexing the elbows
D:rotate the hamstrings

Answers

Answer:

C

Explanation:

Primary functions of the biceps brachii is flexion of the elbow and supination of the forearm. In fact, it is the prime mover of forearm supination. Since it crosses the gleno-humeral joint, it also serves to assist shoulder elevation.

C. Flexing the elbow

Your biceps are in your arms:):)

Which behavior would most likely have a positive influence on body image?

Answers

Answer:

A healthy lifestyle, with a balanced diet and exercise, can contribute to a positive body image.

Explanation:

hope that helps you

working out , eating healthy , and getting a lot of protein and vitamins
hope this helps and i would appreciate if u could make me brainliest

Which might a person having a stroke experience? Check all that apply.

headache

runny nose

stomach pain

difficulty speaking

loss of strength on one side of the body

Answers

headache, difficulty speaking, loss of strength

Answer:

i would say prob. all

Explanation:

give out luvv and smiles

A person wakes up in bed and notices that she is lying on her side. She then decides to sit up and get out of bed. Which groups of nerves are involved in these steps? Select all that apply.

Answers

Answer:Alpha nerve fibers

Somatic nerves

Explanation:

Success can be be defined by
A) making good decisions.
B) defining your values.
C) becoming famous.
D) reaching your goals.

Please help i'll mark brainlest !

Answers

D) reaching your goals. thats yo answerrr

Which two pairs of muscles do not work together
Answers:
Bicep/tricep
Quadriceps/hamstring
Rectus abdominis/pectoralis major

Answers

The rectus abdominis and pectoralis major don’t work together
Your answer will be Rectus abdominis/ pectoralis major.

Because the other two work together. Hope this helps✌

WILL GIVE BRAINLIEST!!!!!
How many vitamins are necessary and essential to keep the human body running?

3

Too many to count

1

6

None are essential

Answers

Answer:

The 5 vitamins all runners need

Explanation:

Nutrition for running that goes way beyond carb loading.

Other Questions
Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns what is the range and domain of this question? im unsure A 45 kg object has a momentum of 225 kg-m/s northward. What is the object's velocity?A. 180 m/sB. 5.0 m/sC. 10,125 m/sD. 0.20 m/s Mrs. Chin paid a 20 percent tip on the bill for lunch.PercentsTotal20%20%20%20%20%100%$2.75$2.75$2.75$2.75$2.75If the tip amount was $2.75, what was the bill for lunch before the tip was added to it?$5.50$13.75$16.50$55.00 4n-(7-6n)Helppp plz Leia just read that the national debt owed by the federal government is at an all-time high. (Explain any possible impact on the federal government from unexpected inflation.)