Which sentence best explains the relationship between pressure and the
solubility of a gas?
A. The greater the pressure, the more gas that will dissolve.
B. Solubility increases with pressure for some gases but not others.
C. The lower the pressure, the more gas that will dissolve.
D. Pressure has no effect on the solubility of gases.

Answers

Answer 1

Answer: A. The greater the pressure, the more of gas that will dissolve.

Explanation: Increasing pressure increases the solubility of gases. It has little effect on the solubility of liquids and solids.


Related Questions

Explain why the electron configuration of 2-3-1 represents an atom in an excited state?

Answers

Answer:

See explanation

Explanation:

If we look at the electron configuration closely, we will discover that the element must have had a ground state electron configuration of 2,4.

This is because, the innermost shell usually holds two electrons while the outer shells hold eight electrons each. The four electrons must be accommodated in the second shell in the ground state configuration of the compound.

However, when the atom is excited, one electron from this shell may move to the third shell to give the excited state configuration 2-3-1 as shown in the question.

Susan is investigating physical changes. To do this, she places some ice into a large bowl and seals it with a lid. She leaves the bowl on the counter for several hours until all of the ice has melted. Using a balance, Susan determines that the mass of both the water and the ice are equal. Why is the mass of the ice and the water the same? (SC.8.P.9.1)

Answers

Answer:

No mass loss

Explanation:

The mass of ice and the water in the different state are equal because the same of quantity of matter is present in both state of matter of matter.

In essence, the mass of the physical change process is conserved. When mass is conserved, matter is neither created nor destroyed but can be changed from one form to the other. This is in compliance with the law of conservation of matter. So, no mass was lost in the physical change process and the mass will remain the same.

how to find the electron in an atom/element

Answers

Answer:

to find the number of electrons an element has locate it on the periodic table of elements find the atomic number and note the number of protons because they are naturally electrically neutral

Answer:

M-A=N

Explanation:

M-A=N

Here is an example.

The equation above means that the atomic number (A) subtracted from the average atomic mass (M) equals the combined amount of neutrons and protons. Since we know that 35 17Cl is Chlorine (this is because Chlorine (Cl) is the 17th number on the periodic table and has the average atomic mass of 35), we can insert our data into the equation and end up with the following:

35-17=18.

From here, we can tell that we have a mix of neutrons and protons, with the total being 18. Since the atomic number is 17, we can reasonably assume that there are 17 protons and 1 neutron.

But we still need to find the number of electrons. Fortunately, the number of electrons is always equivilant to the number of protons and the atomic mass, so we know that the number of electrons is 17.

So, we have;

17 Protons

1 Neutron

17 Electrons

Help me please:(:(:( with my bellwork
for brainiest

Answers

Answer:

Elements are made of only one kind of atom

Compounds are made of 2 or more elements chemically bonded together

Explanation:

Its right there????

HELPPPPPPPPPPPPPPPPPPP

Answers

Answer:

not sure about the first one, but i know SDS provides information about the last 3.

Explanation:

A sound wave moves from a solid material into a liquid. What would happen to the frequency of the sound?

Answers

The frequency of the sound waves travel faster and more effectively in liquids than in air and travel even more effectively in solids.

What is a mixture of sugar and water?

a solution

molecule

a compound

a precipitate

Answers

Explanation:

I think its a solution just me tell me in comments if right

Answer:

A solution

Explanation:

Sugar is soluble in water and would dissolve into the water to form a solution.

Are the atoms really "sharing" electrons

Answers

No they are donating them

How many molecules are equal to 3.25 moles of carbon dioxide?

Answers

Answer:

1.957 × 10²⁴ molecules

Explanation:

The number of carbon dioxide molecules can be found by using the formula

N = n × L

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

From the question we have

N = 3.25 × 6.02 × 10²³

We have the final answer as

1.957 × 10²⁴ molecules

Hope this helps you

explain how to separate sugar from supersaturated sugar solution
guys pls help

Answers

A “supersaturated” solution contains more dissolved material. supersaturated solutions lies in the temperature of the water. more sugar will dissolve in hot water than in cold. Meaning that by separating the 2, only the supersaturated sugar would dissolve leaving the regular sugar untouched.

the force that holds paticles together in the atomic nuecleaus?

Answers

Explanation:

i believe you meant particles*

If you start with 14.0 grams of diatomic nitrogen (N2) how many grams of diatomic hydrogen (H2) will react with it?

Answers

Answer:

I just need points

Explanation:

whegehhwjwjwhehebebejeuhebehejejbebe

Someone please help will mark as brainliest

Answers

Answer:

a1

The main difference between SPECT and PET scans is the type of radiotracers used. While SPECT scans measure gamma rays, the decay of the radiotracers used with PET scans produce small particles called positrons. A positron is a particle with roughly the same mass as an electron but oppositely charged.

Explanation:

a2

While imaging tests such as X-rays can show what the structures inside your body look like, a SPECT scan produces images that show how your organs work. For instance, a SPECT scan can show how blood flows to your heart or what areas of your brain are more active or less active.

a3

PET and SPECT have been extensively evaluated as diagnostic procedures for dementia. Substantial progress has been made in developing radioligands that bind to amyloid deposits in the brain, which should provide new opportunities for early diagnosis and treatment monitoring in Alzheimer's disease

a4

What are the disadvantages of spect as compared to pet?

However, SPECT has issues, including long scan times and low-resolution images prone to artifacts and attenuation. Some artifacts can easily be misidentified as perfusion defects. SPECT also does not provide a quantifiable estimate of the blood flow, whereas PET does, experts say.

How can magnetic force be exerted on objects?

1)Over a distance and anytime an object is in a magnet's field of influence.

2)Only through objects.

3)Only by touching an object.

Answers

I think the answer is : 1

Someone please help will mark as brainliest

Answers

1. solute is the substance that is being dissolve,while solvent is dissolving medium

2.saturated is solution that contain maximum amount of solut that capable of being dissolve and supersaturated is solution that contain less amount or medium of solut that capable being dissolve : example vinger

3. is a number placed in front of a chemical symbol or formula. It shows how many atoms or molecules of the substance are involved in the reaction. For example, two molecules of hydrogen would be written as 2 H2, and two molecules of water would be written 2 H2O . yes it's can be change only in caseWhen you balance an equation you can only change the coefficients

5. Which of the following elements will have a charge of 4+ or 4- as an ion?

Answers

Answer:

The answer would either be Carbon or Silicon.

Explanation:

You have discovered an element that is a poor conductor of electricity, has a low melting point, and is a gas at room temperature. How would you classify this element?


A.metal

B.metalloid

C.actinoid

D.nonmetal

Answers

AHHH ITS B SORRY I ACTUALLY KNOE THIS

If you have 2.0 moles of sodium chloride (NaCl), what is its mass in grams?

Answers

Answer:

117g

Explanation:

Given parameters:

Number of moles = 2moles

Unknown:

Mass of NaCl  = ?

Solution:

To solve the problem, we need to use the expression below;

    Mass of NaCl  = number of moles x molar mass

Molar mass of NaCl  = 23 + 35.5  = 58.5g/mol

 

So;

Insert the parameters and solve;

     Mass of NaCl  = 2 x 58.5  = 117g

Given a balanced chemical equation it is always possible to determine
A)
the physical state of the products and reactants
B)
whether a reaction will or will not take place
C)
the relative number of moles taking part in the reaction
D)
the conditions necessary for the reaction to take place

Answers

Answer:

C)  the relative number of moles taking part in the reaction

Explanation:

From a balanced chemical equation, it is always possible to determine the relative number of moles taking part in a chemical reaction.

The number of moles is the amount of the reacting specie that makes up a chemical reaction.

In balanced chemical equation, the number of moles of reactants and products must be the same. From this understanding, we can determine the amount of reactants and products needed for a chemical reaction to take place.

Which of the following is an intensive property?

Mass
Magnetism
Shape
Volume

Answers

Answer:

I believe its A. Mass

Explanation:

An intensive property is a property of matter that depends only on the type of matter in a sample and not on the amount. For example, the electrical conductivity of a pure substance is a property that depends only on the type of substance. Silver, gold, and copper are excellent conductors of electricity, while glass and plastic are poor conductors.. Other intensive properties include color, temperature, density, and solubility.

Answer:

B. Magnetism

Explanation:

Hope this helps! :))
Sorry for late answer

why is a rise in sea level significant?

Answers

Answer:

I honestly dont know but its cool problably from water fill or from the waves going to much

Explanation:

the answer I can think of is it might be the way the water has waves and it moves a lot

How much oxygen (O) is in 5.41 × 106 atoms of oxygen

Answers

Answer:

They show you  how to do it sweetie

Explanation:

123456789 Common math

a flask of 0.30 L was weighted after it had been evacuated.It was then filled with a gas of unknown molecular mass at 760 mm of Hg and temperature of 300 K. The increase in mass of flask was found to be 0.997 g. Determine the molecular mass​

Answers

The molecular mass​ : 81.72 g/mol

Further explanation

In general, the gas equation can be written  

[tex]\large {\boxed {\bold {PV = nRT}}}[/tex]

where  

P = pressure, atm , N/m²

V = volume, liter  

n = number of moles  

R = gas constant = 0.082 l.atm / mol K (P= atm, v= liter),or 8,314 J/mol K (P=Pa or N/m2, v= m³)

T = temperature, Kelvin  

P = 760 mmHg=1 atm

T = 300 K

V = 0.3 L

Number of moles :

[tex]\tt n=\dfrac{PV}{RT}\\\\n=\dfrac{1\times 0.3}{0.082\times 300}\\\\n=0.0122[/tex]

The molecular mass (MW) :

[tex]\tt MW=\dfrac{mass}{n}\\\\MW=\dfrac{0.997~g}{0.0122}\\\\MW=81.72~g/mol[/tex]

help with this question

Answers

Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

DRAW A PEDIGREE

Read the following information and ON NOTEBOOK PAPER, construct a pedigree using the symbols we went over Tuesday: Scott is married to Christa. They have 3 children, Blake (a son), Peyton (a daughter), and Ashton (a daughter). Blake is married to Allie and they have 2 children, Henry (a son) and Harper (a daughter).

When you have completed your pedigree drawing, take a picture and attach it to this assignment and submit.

Answers

Answer:

Here you go

Explanation:

How many grams are in 7.5 moles of C6H12?



Group of answer choices

0.09g

630g

11.2

84g

Answers

Answer:

630gC₆H₁₂

Explanation:

How many grams are in 7.5 moles of C₆H₁₂?

C₆:12.011×6=72.066

H₁₂:1.008×12=12.096

72.066+12.096=84.162

84.162g/mol C₆H₁₂

7.5 molC₆H₁₂ ×84.162g/molC₆H₁₂= 631.215gC₆H₁₂

How to we measure energy?

Answers

Answer:

The official measurement unit for energy is the Joule (J). Among the most common units measuring energy mention should be made of the kilowatt/hour (kWh), used especially for electric energy (in fact it is used to calculate electricity bills).

With joules hope I helped

A nitrogen molecule (N2) has one triple bond. How many electrons do the nitrogen atoms share?

A. 1
B. 3
C. 4
D. 6

Answers

Answer:

3 electrons

Explanation:

Which will diffuse the most? The particles with the
A. Least potential energy.
B. Most potential energy.
C. Least kinetic energy.
D. Most kinetic energy.

Answers

Answer:

B. Most potential energy

Explanation:

brainest plz

The chemical equation describing the burning of hydrogen gas is: 2H2 + O2 ---> 2H2O.
Why is this both a synthesis and a combustion reaction?

Answers

Answer:

"A combustion reaction is a reaction in which a substance reacts with oxygen gas, releasing energy in the form of light and heat. Combustion reactions must involve O2 as one reactant. The combustion of hydrogen gas produces water vapor." and "A synthesis reaction occurs when two or more reactants combine to form a single product. ... In a double replacement reaction, two compounds exchange elements. A combustion reaction occurs when a substance reacts quickly with oxygen. Combustion is commonly called burning"

Explanation:

I tried

Other Questions
What is the exterior angle sum for a regular heptagon Multiplying fraction what is 5/8x6/15 ((help please)). Identify any constraints on the domain.Every day Isabel swims 10 to 20 laps in a 50-meter pool. She tracks the numbers of laps she swims and how long it takes her to complete the laps, inminutesChoose the correct answer below.O A. The domain consists of all integers greater than or equal to 0.OB. The domain consists of all integers greater than 0 and less than or equal to 20.OC. The domain consists of all integers greater than or equal to 0 and less than or equal to 20D. The domain consists of all integers greater than or equal to 10 and less than or equal to 20.E. The domain consists of all integers less than or equal to 20. Describe "advocacy" service and give two examples. If 1 + 2 = 12 then what's 2 + 4? Is the slope-intercept form and standard form of the same line equivalent? 39. Tugboat A and Tugboat B are pulling a barge. Each tugboat is connected to the barge via acable. If the length of the cables are 72 meters and 77 meters and the tugboats are 35 metersapart, find the angle formed between the cables. how many feet are in one inch Which line of poetry is written in lambic pentameter A map key shows that a map distance of 1/3 inch represents an actualdistance of 417 mile. Find the actual distance represented by 1inch on themap, 7. On a map of a local community college, the cafeteria is located at point (-4,3) and thebookstore is located at point (6,1). What is the distance between the cafeteria andbookstore rounded to the nearest tenth?A. 9.8 units B. 4.5 units C. 10.2 units D. 3.5 units Part A Based on the graph, how many zeros does the polynomial function, f(x) = -x^4 - 3x^3 + 6x^2 + 8x have? Part B What are the zeroes of the above polynomial function? A. -4,0,2,3B. 0, 2 only C. -4,-1, 0, 2 D. -4, 2 only If Bill bikes at an average speed of 8miles per hour, how many hours willit take him to ride 24 miles?198 hoursB32 hours3 hours20 hours To determine the density of an irregularly shaped object, a student immersed the object in 22.2 mL of water in agraduated cylinder, causing the level of the water to rise to 37.8 ml. If the object had a mass of 22.4 g, what is thedensity of the object? In the experiment shown below, which is greater, the force of gravity on the pith balls (Fg) or the electrostatic force between them (Fq)?Fg > FqFg = FqFg < FqNot enough information is given. Im stumped and timed. I need help with just the last question! :) *PLEASE ANSWER THANK YOU*What did Thomas Jefferson do before writing the Declaration of Independence?a.) became a doctor and served as an army medicb.) explored the region west of the Appalachian mountainsc.) wrote a pamphlet rejecting British authority Identify the subject. My father built a new shed in the back yard.fatherbuiltshedyard How did the Great Compromise compare to the Articles of Confederation? A. The resolution, known as the Great Compromise gave more power to the federal government. B. The resolution, known as the Great Compromise gave more power to the state governments. C. The resolution, known as the Great Compromise gave more power to the citizens of the United States. D. The resolution, known as the Great Compromise gave more power to the King of Great Britain