Which word most clearly has a connotation of unpleasantness? OA. Foul OB. Loud C. Distant OD. Hidden​

Answers

Answer 1

Answer:

B. Foul

Explanation:

"offensive to the senses, especially through having a disgusting smell or taste or being unpleasantly soiled."

Hope This Helped


Related Questions

Please help will give 25 points for 1 question if you answer in 15 minutes

Answers

Answer:

I think it is the first one.

Explanation:

Sorry if i got it wrong

I think it’s A not 100% sure

Q.3) It is only an ordinary lead pencil, but if you use it with care.....
Write a paragraph of 100 words about what you might do with a pencil.

Answers

Answer:

cholera is vabro cholera

Which audience and purpose would be most appropriate for the following sentence? Let's all jump into this mess together and see if we can shovel our way out!
4 points
To amuse an unsympathetic audience of friends with angry speech
To inform an audience of strangers about an important issue
To argue an important issue before a sympathetic audience
To argue a minor concern before an audience of young people

Answers

I think it’s C hope this helps

Explain the quote: “Stay away from people who belittle your aspirations. Small people do that. But truly the truly great people in the world make you believe that you, too, can one day become great.” Mark Twain
NEED ANSWER ASAP

Answers

Answer:

dont listen to people who tell you you cant do anything

Explanation:

Read the excerpt from act 1 of The Monsters Are Due on Maple Street.
DON
(picking up the cue)
Sure. That's the kind of thing like sun spots. They raise cane with radio reception all over the world. And this thing
being so close - why there's no telling the sort of stuff it can do.
(he wets his lips, smiles nervously)
Go ahead, Charlie. You and Steve go into town and see if that isn't what's causing it all.
What do the stage directions tell the reader about Don's feelings?
O He feels threatened by Steve and Charlie.
O He may be more worried about the flash than he is admitting.
O He iS confident about the cause of the power outage.
O He knows that Tommy is right but is keeping his feelings a secret.

Answers

Ghcdgffdsachuijg uyggh. Dssvgh. Huff

debate: technology has done more harm than good supporting​

Answers

Answer:

If you look at the pros and cons, the pros heavily outway the cons.

Explanation:

Cons- Kids spend more time indoors then out (so do most adults)

Pros- Many lives have been saved, things have gotten extremely easier compared to when we didn't have this kind of tech, etc.

Speech or writing that includes a claim with evidence and a recognition of the credibility of the opposing viewpoints.

Answers

Speech or writing that includes a claim with evidence and a recognition of the credibility of the opposing viewpoints is an argumentative writing.

What is argumentative writing?

Argumentative writing contains evidence and fact that negate a particular view or opinion.

The essay is written to point out fact that should be accepted.

Therefore, Speech or writing that includes a claim with evidence and a recognition of the credibility of the opposing viewpoints is an argumentative writing.

Learn more on argumentative writing below

https://brainly.com/question/11617771

#SPJ1

Read the excerpt from poe’s "the fall of the house of usher." i reined my horse to the precipitous brink of a black and lurid tarn that lay in the unruffled lustre by the dwelling, and gazed down -- but with a shudder even more thrilling than before -- upon the remodelled and inverted images of the gray sedge. how does this excerpt provide information about the narrator of the story? it describes what the narrator knows from his past. it describes what the narrator experiences in the story. it provides an inference drawn by the narrator. it provides a criticism voiced by the narrator.

Answers

Edgar Allan Poe's story The Fall of the House of Usher describes the experience of the narrator that he goes through the story. Thus, option B is correct.

Who is the narrator?

A narrator is a person that describes a poem, story, etc. from their point of perspective. In the poem, the narrator recounts the events by recollecting the experiences he went through.

He uses the first-person point of view by using words like 'I' that tell about his direct involvement in the events that took place. He used words to express his personal feelings and emotions to the readers.

Therefore, in option B. the narrator's experiences are portrayed.

Learn more about the narrator here:

https://brainly.com/question/11248931

#SPJ1

Answer:

b

Explanation:

Select the correct text in the passage.
Which lines from "Porphyria's Lover change it from a love poem to a Gothic poem that evokes horror?
Porphyria's Lover
by Robert Browning (excerpt)

Answers

The lines from "Porphyria's Lover change it from a love poem to a Gothic poem that evokes horror are "Porphyria's love." He says that Porphyria should in no manner have guessed how her wish (to be with him forever) might be fulfilled.

What is the text about Porphyria's lover?

"Porphyria's Lover" is a poem with the useful resource of the usage of Robert Browning which was modified into first published as "Porphyria" withinside the January 1836 hassle of Monthly Repository. Browning later republished it in Dramatic Lyrics (1842) paired with "Johannes Agricola in Meditation" under the title "Madhouse Cells.

This poem is a dramatic monologue—a fictional speech supplied due to the fact the musings of a speaker who is reduced unfastened the poet. Like most of Browning's unique dramatic monologues, this one captures a 2d after a main event or action. Porphyria already lies dead at the same time as the speaker begins.

Read more about the Porphyria's Lover:

https://brainly.com/question/9088621

#SPJ1

The following are lines from ""Porphyria's Lover" transforms the poem from a love poetry to a Gothic poem that invokes terror. Porphyria should not have predicted how her wish would be fulfilled, he claims.

What is the meaning of Porphyria's lover in the text?

"Porphyria's Lover" is a poem written by Robert Browning and first published in the January 1836 issue of Monthly Repository as "Porphyria." Browning later released it alongside "Johannes Agricola in Meditation" in Dramatic Lyrics (1842) "Cells in a Madhouse

This poem is a dramatic monologue—a made-up speech based on the ideas of a speaker who has been cut loose by the poet. Like the majority of people,

Thus, The following are lines from ""Porphyria's Lover" transforms the poem from a love poetry to a Gothic

For more details about meaning of Porphyria's lover, click here:

https://brainly.com/question/3624588

#SPJ1

This is a public service announcement about vaccinations.

A bee named Wellbee on a poster that reads, "Vaccinated? Get a booster!" From the Alaska Division of Public Health.

What is the purpose of this public service announcement?

to tell people a riddle about vaccinations to make them laugh
to tell kids to talk to their parents about vaccinations
to tell people to make sure to get vaccinated
to tell people why it is important to get vaccinated

Answers

The purpose of this public service announcement is:

To tell people why it is important to get vaccinated

What is a Public Service Announcement?

A public service announcement is a piece of information that is passed to members of the public through the mass media.

The inclusion of a bee is aimed at telling the public that they can be elegant and active like the bee when they get vaccinated. So option D is right.

Learn more about public service announcements here:

https://brainly.com/question/3876593

#SPJ1

can someone explain this better please

Write the sentence that is the topic sentence of the paragraph.
Write the sentence that is irrelevant to the topic and can be eliminated.
List four types of grammatical or punctuation errors to look for when you’re proofreading.
Complete the following two steps:
Define the term cliché.
Give an example of a cliché. Write one sentence using the cliché and another that replaces the cliché with your own original wording.
Name and explain two types of prewriting.
Choose one of the following prompts. Write a five-sentence paragraph using chronological order and including a topic sentence to explain the steps you would take to complete one of the following tasks.
Preparing for a test
Preparing to host a party or an event
Getting ready for work
Cleaning your room or your home
Building a snowman, sandcastle, or sculpture
Creating a budget
Choose one of the following topics. Write an eight-sentence paragraph that fully develops the topic.
Following instructions is very important.
Job-training programs (such as Job Corps) are valuable to both employers and potential employees.
Advances in technology have changed the way people interact with each other.
A high school diploma is important to my future.
For some people, entering the work force is a better choice than going to college.
Having strong writing skills will improve both my personal and professional communication.

Answers

Having strong writing skills will improve personal and professional communication.

What is professional communication?

Professional communication encompasses written, oral, visual, and digital communication within a workplace context.

Having strong writing skills will improve personal and professional communication. Increased articulation in writing will spread to the ways that you talk and think.

When you can put words on paper cleanly and clearly, it will become easier to do so in your speech and this translates to being a better and more smooth communicator each day.

Learn more about communication on:

https://brainly.com/question/26152499

#SPJ1

When you make an inference about a play you are watching, you should then--
Group of answer choices

see if your inference is correct

relax and continue watching the play

visualize what comes next

assume you guessed correctly

I need a answer ASAP i will give 60 points for it

Answers

Answer:

When you make an inference about a play you are watching, you should then see if your inference is correct.

Which is the closest antonym for the word breakthrough?
A.presence
B.setback
C.salute
D.progress

Answers

Answer:

B. Setback

Explanation:

As the meaning of breakthrough it is when someone finally makes a progress and setback means moving backwards no progress

the block and sword in lines 10-13 best represent the…”The Crowning of Arthur”

Answers

In lines 10–13 of The Crowning of Arthur, the block and sword stand in for the mystical elements of medieval romance.

What exactly is supernatural?

It should be remembered that the term supernatural simply refers to something that can be explained by forces that transcend science.

The block and sword in lines 10 through 13 of The Crowning of Arthur here stand-in for the mystical elements of medieval romance.

In conclusion, the correct option is d.

Learn more about supernatural on:

brainly.com/question/6140502

#SPJ1

Which event can be best described as the inciting incident?

Answers

Answer: An occurence in the story plot that will begin a (main) character's problem or theme throughout most of the story.

In the plot of “Cruel Tribute,” which events are a result of King Minos’s actions? Select 3 options

Answers

The events that are a result of King Minos’s actions includes:

Athens agrees to pay the tributeYoung people participate in a lotteryTheseus fights the Minotaur

What is the story of Cruel Tribute?

This is a story where the King Minos seeks revenge and threatens to kill Aegeus' son in the same manner as his son had been killed.

Therefore, the action of King Minos resulted to Athens agreeing to pay the tribute, Young people participating in a lottery and Theseus fighting the Minotaur.

Read more about King Minos

brainly.com/question/552924

#SPJ1

How does Alexander develop the idea that he has served his people well?

A.He criticizes his father’s accomplishments.
B.He says other countries respect him as a leader.
C.He lists ways he has expanded his people’s empire.
D.He claims that his army and navy are the world’s strongest.

Answers

The correct answer is d

He claims that his army and navy are the world’s strongest is the Alexander develop the idea that he has served his people well. Hence, option D is correct.

What served as Alexander the Great's greatest inspiration?

Alexander had a tremendous amount of ambition and was inspired by Achilles, Heracles, and Dionysus. Additionally, he fostered the growth of Hellenistic culture and demonstrated a keen interest in education.

The Macedonian emperor Alexander the Great conquered Egypt, the Middle East, and parts of Asia in a relatively short period of time. His dominance changed the region's history and significantly influenced the cultures of the areas he conquered.

Alexander the Great has had a wide-ranging and profound impact. The Greek city-states were initially successfully unified by his father, and Alexander ultimately overthrew the Persian Empire.

Thus,  option D is correct.

For more details about Alexander the Great's greatest inspiration, click here:

https://brainly.com/question/14669436

#SPJ2

Juliet is often portrayed on a balcony because:
A. the stage direction says that she enters from "above."
OB. Shakespeare titled the play "The Balcony Scene."
C. Romeo says that he sees her on a balcony.
D. the stage direction says that she enters from "a balcony."

Answers

Juliet is often portrayed on a balcony because the stage direction says that she enters from "a balcony."

Why is Juliet is in her balcony?

Juliet, always seen on her balcony because it portrays the scene of love between Romeo and Juliet. The play was set to stand Juliet in the balcony alone, but Romeo is there for her.

Thus, the correct option is D. the stage direction says that she enters from "a balcony."

Learn more about Romeo and Juliet

https://brainly.com/question/1409935

#SPJ1

Although buying a certificate of deposit can earn your higher returns than a regular savings account, it can have the negative side effect of _________. a. needing frequent transfers to stay active b. requiring a high initial investment c. being taxed when invested and when withdrawn d. having to be tied to a fixed rate saving account please select the best answer from the choices provided a b c d

Answers

Although buying a certificate of deposit can earn your higher returns than a regular savings account, it can have the negative side effect of B. Requiring a high initial investment .

What is a Certificate of Deposit?

This refers to the accounting term that is used to show that a holding bank account would be able to earn interest over time.

Hence, we can see that the use of a certificate of deposit can have some good advantages but it has some drawbacks and the correct answer is option B because of its high initial investment.

Read more about certificate of deposit here:

https://brainly.com/question/1597031

#SPJ4

For questions 21-22, underline the adjective clause and circle the noun it is modifying.

21. The man who heeds the word wisely will find good.

22. The package that is in the hall is moving.

Answers

21. The (man) [who heeds the word] wisely will find good.

22. The (package) [that is in the hall] is moving.

() = circle [] = underline

I'm like 80% confident on this one, sorry :/

example of colonisation

Answers

Africa boasts a tradition of higher education institutions that predate Western coloniza

Which word below would best complete the following sentence, based on the connotation?

The excavation ground to a halt when the local government _________ the permits for digging.

manipulated
lost
revoked
added

Answers

Answer:

Revoked

Explanation:

The definition of revoked means "put an end to the validity or operation of (a decree, decision, or promise)"

Answer:

Revoked

Explanation:

See here the authority needs the permission for diggingIf persmission won't given then they can't digSo here permission is not give hence revoked

Should people have the legal right to download copyrighted music for free

Answers

Answer:

No, they shouldn't.

Explanation:

Copyrighted music is made by the owner and the owner of it will let you use it if they want to. For example, the album Harry's House by Harry Styles and the album Don't Forget by Sky Ferreira were both leaked and downloaded by millions everywhere around the world, they never wanted people to leak them but sadly it did. I think that the right to download copyrighted music shouldn't be allowed unless the person who made the music allows it to be.

Which do you like best, the wrapper or the maxi?. what is the correct sentence.​

Answers

The wrapper longer and stronger

What does the speaker observe in "Night"?
the suffering of a rose
the coming of the dawn
the corn harvest
the death of a tree

Answers

In the poem as given above, the suffering of a rose is explained to be observed by the speaker in the 'Night'.

Who is a speaker?

A speaker or a narrator is someone who tells about the entire story or any such literary composition throughout its continuity. In the given story, the speaker says that a rose cannot glow and spread its positivity at Night.

Hence, option A holds true regarding the observation of speaker.

Learn more about a speaker here:

https://brainly.com/question/12291555

#SPJ1

Read the excerpt from "Lewis Hine Helps a Nation See the Light."Which statement gives a historical detail that can clarify a reader's understanding of the excerpt?

Answers

The statement gives a historical detail that can clarify a reader's understanding of the excerpt is Children did not get the chance to go to school because they had to work every day from morning to evening.

What is "Lewis Hine Helps a Nation See the Light"?

It is a passage about Lewis Hine who was born in 1874 in Wisconsin. He was a teen and worked in a factory, but he wanted to complete his studies and college.

The statements are attached:

Children lost all interest in going to school because they were making so much money working. Children did not get the chance to go to school because they had to work every day from morning to evening. Children did not have to go to school because they were being taught at home by their parents. Children decided not to go to school because they had so much fun during their free time.

Thus, the correct option is B.

Learn more about "Lewis Hine Helps a Nation See the Light"

https://brainly.com/question/8959324

#SPJ1

PLEASE HELP ME
Write a short script of approximately twenty lines of dialogue that includes a clear conflict and theme. Be sure CO set the scene, include
stage directions and dialogue between two or more characters, and craft a conflict and resolution that establishes a theme.

Answers

Some tips to show how to write some lines of script that contains dialogue, conflict and themes are:

Write about a themeShow your charactersUse dialogue between the characters to develop this themeShow minor and major conflictsUse plot elements like exposition, rising action, etcUse literary elements like foreshadowing, imagery, etcConclude

What is Dialogue?

This refers to the interaction between two or more people where they exchange words and get feedback.

Hence, we can see that based on the given question, to make an effective dialogue, you would need to use dialogue, show conflict, use plot elements, etc.

Read more about dialogue here:

https://brainly.com/question/24374672

#SPJ1

Change 6 past tense verbs to the present tense.

I am honest, reliable, and work well on my own initiative and as part of a team. I prided myself on treating others with respect and co-operated well with colleagues. I am confident that I have all the skills and experience required for the position of Warehouse Assistant/Forklift Truck Driver.

Answers

Answer:

I am honest, reliable, and work well on my own initiative and as part of a team. I pride myself on treating others with respect and cooperate well with colleagues. I am confident that I have all the skills and experience you require for the position of warehouse Assistant/ Forclift Truck Driver

Explanation:

my answer is in present tense

Q3. Letter Writing (to be done on the loose sheet)


As part of your extracurricular activities, your Principal wants your class to hold a party for young school children. She asks you to explain in a letter how you would organize the event. Write between 200-250 words. (13)


Write your letter and include the following points.


· When and where the party will be held


· How you will decorate the place and details of the entertainment


· How you would like your teachers to be involved.


You must cover all the points in detail. You should add further details if you wish and make your letter and persuasive.

Answers

The type of letter to be written is a formal letter. A formal letter is an impersonal letter written to people in authority. A formal letter requires two addresses. Read below about formal letter.

What are the formats of a formal letter?

The following are the formats of a formal letter:

Writer's addressDateRecipient's addressSalutationTitle/ HeadingBody - introduction, body and conclusion)Complementary closeSignatureFull name

Therefore, the correct answers are given above.

learn more about formal letter: https://brainly.com/question/24140747

#SPJ1


Which question should a reader ask to identify an author's purpose?

Answers

Answer:

The reader should ask, "Why did the author write this text?"

Other Questions
Evaluate the following for the given values. 7xy - y + x - 1 for x = -2 and y = -1 Which term matches the picture? What hint does the author of how to jump start a battery give for remembering that you should connect the positive clamp onto the battery before the negative clamp Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!!